1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
statuscvo [17]
3 years ago
5

4.) The DNA sequence above is found on a chromosome in a eukaryotic cell. The cell is allowed to undergo DNA replication and mit

osis in a solution containing radio-label free nucleotides. These nucleotides are similar to a normal free nucleotides found in the cell, but contain a radioactive atom.
4.c) Which of the resulting daughter cells will be radioactive? Explain
Biology
2 answers:
Ira Lisetskai [31]3 years ago
7 0

Answer:

whats the DNA sequence

Explanation:

Scrat [10]3 years ago
3 0

Answer:

The DNA of a bacteria is labeled with radioactive phosphate. Following mitosis, each daughter cell will have:Answer-1/2 the radioactivity of the parent.... Durning mitosis, each strand is replicated at the origin of replication and undergoes PMAT.

You might be interested in
Lipoproteins contain cholesterol and triglycerides.<br><br> True<br><br> False
rodikova [14]

Answer:

it is true..they contain cholestrol and triglycerides.

5 0
3 years ago
Answer the questions below. Will mark the correct answer as brainliest and report irrelevant answers.
TiliK225 [7]

Answer:

The reasons are the following.

Explanation:

Bear can live on land in a very cold regions of earth with the help of its thick skin and more hair on its body.

Frogs lives on lands due to its body structure and food availability. It has sticky tongue that captures insects.

Humans lives on lands not in water due to its body structure because its body structure can't allow humans to live in water due to absence of gills.

Seagull lives in the aquatic ecosystem because seagull feeds on fishes and other marine animals.

Sharks lives in water due to its body structure such as gills that are used to respire in water and the shark can't respire without water.

Meerkat lives in the arid climate because they lives underground to save themselves from the environment and the presence of food.

Protea lives in desert due to their dry skin that can tolerate the warm temperature.

Lions lives in the jungle due to the presence of food such as deer, buffalo etc and warm environment.

Dragonfly lives on land and water due to feed on the larva of mosquitoes that is present in the water bodies and good environmental conditions.

6 0
3 years ago
True or False. A hypothesis that is firmly supported by investigative research and scientific study is proven.
morpeh [17]
The answer to this is true
4 0
3 years ago
Read 2 more answers
Which step of scientific inquiry involves organizing and interpreting the data?
vekshin1

Answer:

The options:

a. Experimentation

b. Analysis

c. Conclusion

d. Hypothesis

The CORRECT ANSWER IS b.

b. Analysis

Explanation:

Good Morning! The scientific process is grouped into stages.

The hypothesis (results from the observation)

The experiment (shows the result of the hypothesis)

The analysis (data is organized and interpreted).

Boom! Our answer is b) Analysis.

7 0
3 years ago
Which item in the photo is a good thermal insulator, and why?
svetoff [14.1K]

Answer:

free electrons can go through the material such as they are most through loses send the water inside the vegetables of human skin is not very good inspiration because its water if you had to take a warm shower and then come out you feel very cold

7 0
3 years ago
Other questions:
  • Name 3 directions lightning can travel.
    15·1 answer
  • What are differences between sperm and egg?
    9·1 answer
  • What did Elodea, Muscle, Fungus all have in common?
    15·1 answer
  • What is the correct form for writing binomial nomenclature?
    11·1 answer
  • 1)Most of the food we eat can be influenced by whom?<br><br> 2)Food choices come from what?
    11·1 answer
  • Which is a leading theory for the formation of fossil fuels? ONitrogen fixated , forming hydrocarbons . B. Earth's magnetic fiel
    11·1 answer
  • Which two factors are responsible for seasons on Earth?
    13·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • The average height of man 100 years ago was 5'5", today the average height is 5'8". Why are we getting taller?
    11·1 answer
  • What is the GDP per capita in Nicaragua?<br> $3,900<br> $5,900<br> $7,900<br> $9,000
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!