1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bezzdna [24]
3 years ago
15

Where is mRNA created?

Biology
1 answer:
alekssr [168]3 years ago
8 0
In the nucleus of a cell.
You might be interested in
Which is not a physical change in the digestive system?
bulgar [2K]

Answer:

C

Explanation:

it is chemical, not physical

6 0
2 years ago
Which of the following statement is true of a semi-conservative model of replication?
Ratling [72]
Answer - A
Semi-conservative model of replication involves the replication of DNA in all the familiar cells in such a way that each newly synthesized daughter cell contains a double helix with one new strand and one old strand.

4 0
2 years ago
Read 2 more answers
Wind shear can result in the formation of a _______.
Free_Kalibri [48]
Wind shear can result in the formation of a tornado
8 0
3 years ago
Read 2 more answers
DNA in the nucleus carries the genetic code for making proteins in ribosomes. The diagram shows a model of DNA. Which part of th
bekas [8.4K]
You didn’t attack a picture. However, the codons on the mRNA are what code for the amino acids.
5 0
3 years ago
I need help please asap ​
ruslelena [56]

Answer: the canine parvovirus infection is digestive

giardiasis is also digestive

tracheobronchitis is respitory

feline viral rhinotracheitis respitory

coccidios im pretty sure that is digestive

Explanation:

3 0
2 years ago
Other questions:
  • Which of these is NOT a type of cellular transport?
    8·2 answers
  • What technique is used by all three branches of science to make discoveries
    13·1 answer
  • If parent 1 tt crosses with parent 2tt what percentage
    9·1 answer
  • 1. What is the role of a receptor in helping an
    11·1 answer
  • Pure gold is an example of a(n) _____.<br><br> element<br> compound<br> mixture<br> solution
    11·1 answer
  • A magnifying glass is an example of which type of microscope?
    9·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • To which group does this worm belong?​
    8·2 answers
  • plant reproduction requires the presence of auxins, as well as a large amount of sugar for energy. which two main plant tissues
    11·1 answer
  • A bean plant produces a seed
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!