1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marina86 [1]
3 years ago
11

Question 1

Biology
2 answers:
tensa zangetsu [6.8K]3 years ago
7 0

Answer:

1)become sediment quickly

2)heart cells

3)nucleus

4)the types of cells near the site

5)cells

Explanation:

I just took the test

Nadya [2.5K]3 years ago
5 0

Answer: Question 1 answer: Skin cells continually replicate

Explanation: The cells in the superficial or upper layers of skin, known as the epidermis, are constantly replacing themselves. This process of renewal is basically exfoliation (shedding) of the epidermis. But the deeper layers of skin, called the dermis, do not go through this cellular turnover and so do not replace themselves.

Question 2 answer: Heart cells undergo terminal differentiation

Explanation: Different cell types (e.g., neurons, skeletal and heart myocytes, adipocytes, keratinocytes) undergo terminal differentiation, in which acquisition of specialized functions entails definitive withdrawal from the cell cycle.

Question 3 answer: DNA replicates in the nucleus

Explanation: DNA replication occurs in the cytoplasm of prokaryotes and in the nucleus of eukaryotes. Regardless of where DNA replication occurs, the basic process is the same. The structure of DNA lends itself easily to DNA replication.

Question 4 answer: The ability to reverse terminal differentiation might affect gene expression in a complex organism

Question 5 answer Cytoplasm replicates during mitosis

Explanation: This process involves replication of the cell's chromosomes, segregation of the copied DNA, and splitting of the parent cell's cytoplasm. ... The outcome of binary fission is two new cells that are identical to the original cell.

You might be interested in
How do lipids differ from one another in function?
algol [13]

Answer:

The three fatty acids can be different from one another. Since the hydrocarbon chains are very non-polar, fats do no dissolve in water; instead, fat molecules tend to coalesce with one another. Since a fat molecule has 3 fatty acids connected to a glycerol molecule, they are also called triglycerides.

6 0
3 years ago
Regardless of an object's position in space, its _______ remains constant.
777dan777 [17]
It’s mass stays constant .weight changes depending on gravitational force
8 0
3 years ago
Read 2 more answers
Are rocks hard i dont know if rocks are hard
Ray Of Light [21]
It is extremely useful for geologists, because most specimens of a given mineral are very close to the same hardness. ... So, we can conclude that not all the rocks are hard, and the hardness of rocks depends on how the atoms of the rock's minerals are bound to each other and how they are arranged.
8 0
3 years ago
A salad contains lettuce eggs bread crumbs and olive oil. name two macromolecules contained in this salad, and describe their ef
valina [46]
The two macro molecules contained in the salad with the lettuce, the eggs, also the bread crumbs and some olive oil is the protein and carbohydrates. The protein can help one person to grow and repair one's injury or wounds. While the carbohydrates as every one know, it provides the human's body the energy.
8 0
3 years ago
According to the U.S. Endangered Species Act (ESA), the difference between an endangered species and a threatened one is that
Alla [95]
A.
Endangered species is closer to extinction


Threatened ones are closer to becoming endangered
7 0
3 years ago
Read 2 more answers
Other questions:
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Bears and coyotes both consume large plant-eating mammals such as deer. When the deer are in short supply, bears and coyotes may
    11·1 answer
  • Label roles of the phytoplankton
    10·1 answer
  • How much protein should Sarah add to her diet if she gets pregnant?Sarah's protein requirements during pregnancy would be higher
    6·1 answer
  • Obesity. definition.
    9·2 answers
  • The light reaction of photosynthesis puts carbon dioxide into the form of carbonhydrates
    5·1 answer
  • What are 3 things that are carried by our blood?
    7·2 answers
  • How does the paramecium expel water? Is this a process of active or passive transport
    9·2 answers
  • use your understanding of genetics and explain how a set of twins can result in one individual who is male and one who is female
    13·1 answer
  • Yhe _______________ glands secrete chemicals called hormones directly into the bloodstream.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!