1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
7nadin3 [17]
3 years ago
15

What effect would an increase in venous tone have on mean arterial pressure?

Biology
1 answer:
Luda [366]3 years ago
3 0
An expansion in venous tone will increment heart yield and increment mean blood vessel weight. All blood vessel and venous vessels under basal conditions display some level of smooth muscle compression that decides the breadth, and thus tone, of the vessel.
You might be interested in
HELP PLEASE WILL GIVE BRAINLY! <br><br> What is a complementary RNA strand to AGA?
Irina18 [472]

Answer:Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

Explanation:

5 0
3 years ago
In many tropical rainforests, people clear land by cutting down trees and burning them. After a few years, the soil runs out of
julia-pushkina [17]

Answer:

The polution from burning the trees. Also, the loss of oxygen from the loss of trees.

Explanation:

hope this helps a little

8 0
2 years ago
Which best exemplifies an ecological community
Soloha48 [4]

Answer:

For example, a forest of trees and undergrowth plants, inhabited by animals and rooted in soil containing bacteria and fungi, constitutes a biological community. A brief treatment of biological communities follows. ... The various species in a community each occupy their own ecological niche.

4 0
3 years ago
What's true about all three of the first babies?
san4es73 [151]

Answer:

B. They all have the same genes but some have hair and some don't

Explanation:

Type I genes tend to be involved in immune response or sensory receptors while type III genes are involved in cell to cell signalling and type II genes are a complex mix of all three types.

6 0
2 years ago
Read 2 more answers
What type of plants can reproduce through seeds?​
valentinak56 [21]

Most plants grow from seeds. These seed plants fall into two groups, <u>angiosperms</u> and <u>gymnosperms</u>.

hope this helps ^^

5 0
3 years ago
Other questions:
  • quizloet Depolarization of a cardiac muscle cell occurs as the result of a decrease in the permeability of the cell membrane to
    13·1 answer
  • The role of chlorophyll in photosynthesis is to A. Pass electrons to the stroma B. Split water molecules C. Absorb light energy
    7·2 answers
  • Which kingdom has more more individual organisms than any of the other 5 kingdoms? (Bacteria)
    11·1 answer
  • What is the processor in a negative feedback loop
    12·1 answer
  • Record your answer from lab exercise #1, step 1, question 1.what time in hours:minutes:seconds gmt did the p waves arrive?
    12·1 answer
  • In the open a tsunami wave is___
    13·1 answer
  • The grizzly bear feeds on salmon that migrate upriver from the ocean during the spawning season. These fish are rich in carbon,
    9·2 answers
  • What does analyzing data and graphs or charts allow you to do
    7·2 answers
  • Scientists in different parts of the world study the path and speed of a newly discovered comet. If the results of the studies a
    14·2 answers
  • This is the type of succession that
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!