1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blondinia [14]
3 years ago
11

Plants get their energy from __________. A. the wind B. the soil C. the Sun

Biology
1 answer:
BabaBlast [244]3 years ago
3 0
The sun!

Answer is C. The Sun.
You might be interested in
A 14-year-old boy has been brought to the emergency department by his mother in excruciating pain that is radiating from his scr
kykrilka [37]
The answer would be testicular torsion.

The diagnosis for pain in the scrotum in a male patient would be either epididymitis or testicular torsion. Cremaster muscle will lift the testis and lessen the pain in case of testicular torsion. E<span>xtensive cremaster muscle contraction observed makes testicular torsion is more likely in this patient.</span>
3 0
3 years ago
According to the sliding filament theory of muscle contraction, the physical changes that occur in the sarcomere during contract
tatyana61 [14]

Answer:

A. The I bands and H bands get smaller and the A bands remain the same size.

Explanation:

The dark-colored central region of the sarcomere that extends the entire length of the thick filaments makes the A band. It also includes the part of the thin filaments that overlap the thick filaments. The lighter region of the sarcomere consisting of the rest of the thin filament but no thick filament makes the I band. The H zone is the narrow region present in the center of each A band and consists only of thick filaments.

During muscle contraction, myosin heads pull the thin filaments towards the M line. This makes the thin filaments to slide inward to allow their ends to overlap and meet at the center of the sarcomere. This makes the I band and H zone narrower. The I band and H zone are disappeared during maximum muscle contraction. Sliding of thin filaments does not change the width of A band which remains unchanged.

5 0
3 years ago
20 PTS
frez [133]
He couldn't explain how they moved

6 0
3 years ago
Read 2 more answers
The _____ Desert expands by hundreds of square miles each year. Sahara, gobi, mohave
Allisa [31]

Answer:

Gobi

Explanation:

6 0
3 years ago
Read 2 more answers
What type of genetic material do viruses contain ?
dmitriy555 [2]
Most viruses have either RNA or DNA as their genetic material. The nucleic acid may be single- or double-stranded. The entire infectious virus particle, called a virion, consists of the nucleic acid and an outer shell of protein.
5 0
3 years ago
Other questions:
  • Which one is larger a main sequence star or a neutron star
    8·1 answer
  • _____ is the distance between corresponding points of adjacent waves <br><br> Helllppp!!!
    6·2 answers
  • Is a pelican a herbivore carnivore or omnivore?
    10·1 answer
  • How do fossils and fossil records support the idea that life change over time? How is the fossil age measured?
    14·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • How is the geologic time scale divided?
    6·1 answer
  • How do geologic timelines help scientists?
    9·1 answer
  • Which is the largest of the rotator cuff muscles
    9·1 answer
  • Explain the processes of photosynthesis and cellular respiration
    14·1 answer
  • Given the strand of DNA with the sequence : G-A-C-A-T-T-C-C-G...
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!