1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sweet [91]
3 years ago
14

System formed by the interaction of organisms and their environment is called a(n) _______.

Biology
1 answer:
Maslowich3 years ago
6 0
The answer is an ecosystem.
You might be interested in
Write a paragraph of at least 200 words to describe the viral replication cycle. be sure to discuss the difference between a lyt
oksian1 [2.3K]
-The cycle is referred to bacterial viruses, it is one of the two cycles of viral reproduction, It results in the destruction of the infected cell.
- The lysogenic cycle is the other cycle of viral reproduction, It is characterized by the integration of the bacteriophage nucleic.
- Lysogenic cycles can also occur in eukaryotes.
- The difference between the lytic and lysogenic cycle is that:
- a lytic cycle, the viral DNA exists as a separate molecule in the bacterial cell and reproduce from the host bacteria DNA.
-In the lysogenic phase cycle, the location of viral DNA is in the host DNA.
- In the two cycle using the host DNA but in the lytic phage cycle, the phage is free floating separate molecule to the host DNA.

5 0
3 years ago
Read 2 more answers
Structure of penicillin G​
cestrela7 [59]

Answer:

Benzylpenicillin, also known as penicillin G, is an antibiotic used to treat a number of bacterial infections. This includes pneumonia, strep throat, syphilis, necrotizing enterocolitis, diphtheria, gas gangrene, leptospirosis, cellulitis, and tetanus. ... Benzylpenicillin is given by injection into a vein or muscle.

Explanation: https://pubchem.ncbi.nlm.nih.gov/image/imgsrv.fcgi?cid=5904&t=l

3 0
3 years ago
8 Make a claim about the age of the lower layers relative to the age of the upper layers in the sedimentary rock shown above. Pr
ki77a [65]

Answer:

The relative age of a rock then is its age in comparison with other rocks. If you know the relative ages of two rock layers, (1) Do you know ...

Explanation:

4 0
2 years ago
What enlightenment principles did the state constitutions all put into practice?
Aleksandr [31]
I think it was the creation of natural rights and the Declaration of Independence. These ideas were ignited during the Age of Enlightenment, wherein people learn to reason and rationalize the things and situation around them. They were able to hone the idea of democracy as well as improved the idea of government, which pave way to creation of constitutions and city-states
7 0
4 years ago
A codon is a set of three nucleotides that correspond to a specific amino acid. The table below shows various DNA codons and the
Finger [1]

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), th

Explanation:

6 0
3 years ago
Other questions:
  • What type of amino acids will be present where integral proteins attach to cell membranes?
    5·1 answer
  • Elizabeth and Steven are pushing the cabinet to the right. Elizabeth applies 5 a force of 40 N and Steven exerts a force of 55 N
    11·1 answer
  • A nurse is caring for a client who has a history of sleep apnea. the client understands the disease process when he says:
    9·1 answer
  • All but one factor plays a part in water movement in and out of the cell. that is
    12·1 answer
  • Which of the following lists the steps of technological development in the
    13·2 answers
  • What is the physiological significance of the presences of myelin on an axon?
    10·1 answer
  • If a claim is mainly supported by anecdotal evidence (stories or claims by people), It is<br> likely
    7·1 answer
  • Some factories release various types of waste into the air through the burning
    5·1 answer
  • Augustine is writing an essay on stem cells. Help him by completing the sentences. Stem cells have the ability to divide and pro
    14·1 answer
  • What does erosion do?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!