1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Thepotemich [5.8K]
2 years ago
7

In the blood, about 99% of the oxygen is:

Biology
1 answer:
PIT_PIT [208]2 years ago
5 0
Is hemoglobin
i hope this will help you
You might be interested in
How does a solution become saturated?
Varvara68 [4.7K]
Hey there,
The solution become saturated when all the solution has dissolved in a solvent,

Hope this helps :))

<em>~Top♥</em>
3 0
3 years ago
Read 2 more answers
What factor determines how often two alleles for a gene will recombine?
EastWind [94]
The physical distance that separates them on the chromosome.
7 0
2 years ago
Which organism is a primary consumer? krill elephant seal squid penguin
galina1969 [7]
Krill should be ur answer hope this helps! have a nice day


7 0
3 years ago
Read 2 more answers
During ur last shift, 20 babies were born. 10 had blue eyes, and 10 had brown eyes
Nady [450]
Each person then has 4 total alleles that determine their eye color. The B allele (brown) is always dominant. The blue eye trait is always recessive.
5 0
2 years ago
Read 2 more answers
Air that enters the pleural space during inspiration but is unable to exit during expiration creates a condition called
azamat

Air that enters the pleural space during inspiration but is unable to exit during expiration creates a condition called Pneumothorax.

<h3>What is Pneumothorax?</h3>

An abnormal buildup of air in the pleural space between the lung and the chest wall is known as a pneumothorax. Shortness of breath and quick, acute, one-sided chest discomfort are common symptoms .  A tension pneumothorax happens when an area of injured tissue forms a one-way valve, increasing the amount of air in the gap between the chest wall and the lungs.  As a result, there may be an oxygen deficiency that worsens with time and low blood pressure. Obstructive shock is a type of shock that results from this and can be lethal if left untreated.  A pneumothorax can very infrequently affect both lungs.  Although the term "collapsed lung" can also refer to atelectasis, it is frequently used to describe it.

Learn more about Pneumothorax with the help of the given link:

brainly.com/question/27974865

#SPJ4



4 0
9 months ago
Other questions:
  • Do arthropods have three embryonic germ layers
    13·1 answer
  • The DNA in a cell's nucleus encodes proteins that are eventually targeted to every membrane and compartment in the cell, as well
    8·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Can somebody sort these correctly? 6/10 are correct! Mitosis vs Meiosis
    11·1 answer
  • Which of the following accurately describes a characteristic of fungi? 
    6·1 answer
  • Which process is a common practice that has been used by farmers for hundreds of years to develop new varieties of plants and an
    13·1 answer
  • Classify as man-made or natural extinction: Pollution
    12·1 answer
  • If a person did not eat for serveral days, which sequence of events would occur
    10·1 answer
  • true or false Carbohydrate-rich sports drinks should not be given to athletes during endurance sport participation because blood
    13·1 answer
  • Who might benefit from this claim?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!