1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexira [117]
3 years ago
10

Give one common characteristic of hardwood trees

Biology
1 answer:
ohaa [14]3 years ago
3 0

Hardwood trees have a lot of bark.

(I hope this is good enough.)

You might be interested in
True or false: both the hormone adrenaline and stimulation by the vagus nerve accelerate the heart rate.
damaskus [11]

The vagus nerve has several functions, including slowing the heart rate. There are several simple vagal maneuvers you can do to trigger the vagus nerve to slow down an accelerating heart rate. This is a condition known as tachycardia.

<h3>Does the vagus nerve control heart rate?</h3>

Parasympathetic control of the heart via the vagus nerve is the primary mechanism that regulates beat-to-beat control of heart rate.

Additionally, the vagus nerve exerts significant effects at the AV node, as well as effects on both atrial and ventricular myocardium.

<h3>What is the function of the vagus nerve?</h3>

The vagus nerve is responsible for the regulation of internal organ functions, such as digestion, heart rate, and respiratory rate, as well as vasomotor activity, and certain reflex actions, such as coughing, sneezing, swallowing, and vomiting.

Learn more about vagus nerve here:

<h3>brainly.com/question/14297015</h3><h3 /><h3>#SPJ4</h3>
8 0
2 years ago
Need help please and thanks
schepotkina [342]

Answer:

1)double 2) nitrogen bases 3)sugar and phosphates 4)guanine

Explanation:

just trust me

7 0
3 years ago
Dosage compensation leads to a variety of interesting coat color patterns in certain mammals. For instance, a female cat that is
Free_Kalibri [48]

Answer:

Explanation:

The genetic determination of coat colors in calico cats is linked to the X chromosome wherein calicos are nearly always female, with one coat color  allele linked to the maternal X chromosome and a second coat color allele linked to the paternal X chromosome.

Since, the females possess two X chromosomes (XX), they can be either homozygous for each coat colour or be heterozygote (calico). But in the males, since this trait is X- linked and males have just the one X chromosome (XY), they can only possess either of the coat colour and not be an heterozygote. But an XXY male cat can be a calico due to the presence of the two X chromosomes.

6 0
3 years ago
g Wilderness ecosystems are dynamic, complex, and often fragile, and may be impacted by human use and activities occurring both
ipn [44]

The given statement "wilderness ecosystems are dynamic, complex, and often fragile, and may be impacted by human use and activities occurring both within and outside wilderness boundaries," is true.

Wilderness ecosystems

The wilderness ecosystem is the ecosystem that has been left undisturbed by humans. There are many areas on the planet that are considered wilderness such as the Great Barrier Reef, the Amazon forest, etc. They are rich in both flora and fauna diversity.

In the United States, a total of 42× 10^{4} ha is under the protection of the National Wilderness Prevention System. They are the lands devoted to the protection of the natural ecosystem. Such an arrangement had to be made due to human encroachment and various other factors that affect the wilderness ecosystem. The main threats to the wilderness ecosystem are

  • Using the land for recreational uses
  • Grazing by livestock
  • Forest fire
  • Pollution
  • Global warming
  • Invasion of alien species
  • The unnatural flow of water due to diversions, dams, impoundments, etc.

Learn more about ecosystems here:

brainly.com/question/12737609

#SPJ4

4 0
2 years ago
How is NADPH different from NADP+? A. It has lost one electron B. It has gained one electron C. It has gained one proton D. It h
stiv31 [10]
The answer would be C It has gained one proton
8 0
3 years ago
Read 2 more answers
Other questions:
  • The neurotransmitter _____, which helps to control the preciseness of the signal sent from one neuron to another, decreases with
    6·2 answers
  • A Native American saying states that, “We do not
    9·1 answer
  • The peripheral nervous system consists of all the nervous tissue external to the cns true or false
    6·2 answers
  • What is the result of a cross between one parent that is blood type AB and another parent whose blood type is O?
    7·1 answer
  • PLEASE HELP ASAP
    12·1 answer
  • What is the importance of the genetic code?
    10·1 answer
  • Imagine that your lab is synthesizing a new type of cell. One of your colleagues suggests that your synthetic cell should use pr
    9·1 answer
  • What are the environmental and economical<br> uses of soil?
    7·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • How does the body determine whether various chemicals in the body are at acceptable<br> levels?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!