1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vlada [557]
3 years ago
9

Which solution decreases in volume when a semipermeable membrane is placed in between?

Biology
1 answer:
elena55 [62]3 years ago
6 0
The less concentrated solution, aka the solution with more water molecules. Water molecules will move from a higher water potential region to lower, by osmosis, which requires a semi permeable membrane
You might be interested in
Choose a starting
NNADVOKAT [17]

Answer:

Nitrogen is present in the atmosphere in a molecule form about 78 percent. This nitrogen comes to the earth with the water through rainfall. Some nitrogen fix by beneficial microorganisms such as Cyanobacteria and Azotobactor which are present in the roots of higher plants. These microorganisms convert nitrogen molecule into nitrates and used by the plants. There are some other microorganisms which again convert nitrate into nitrogen molecules, called denitrifying bacteria and nitrogen molecule goes to the atmosphere again and complete the cycle.

4 0
3 years ago
3.The reduced potential causes hundreds of a)________________________ channels to open on that part of the cell membrane. The de
wlad13 [49]

The reduced potential causes hundreds of <u>voltage-gated sodium</u> channels  to open on that part of the cell membrane. The depolarization of the cell causes more of <u>voltage-gated sodium </u>channels to open in adjacent parts of the cell membrane. This begins the wave of of <u>depolarization</u>  moving down the axon. Depolarization begins at the <u>axon hillock.</u>

Explanation:

When there is no neuron signaling it becomes polarized, termed as resting membrane potential (RMP) at a threshold voltage (around -55 mV), due to the action of the sodium-potassium pump and the potassium leak channels.  

When a change in the RMP occurs, depolarization takes place which causes the voltage-gated sodium channels to open and sodium ions rush into the nerve cell which in turn will increase the voltage threshold to nearly around +40 mV and also charges the neuron positive. This depolarization moves down the axon. This increase in threshold stops the sodium influx and opens the potassium channels to rush the potassium out of the cell.

All these actions decrease the membrane potential leading to a wave of depolarization and going back to resting state. Depolarization begins depending upon the potential gradient at the axon hillock.

8 0
4 years ago
What are the products of photosynthesis? Which of these
artcher [175]
The products are glucose and oxygen
And
Oxygen is released from leaves as a gas
The equation is
6carbon dioxide+6water____6water+6oxygen

I hope that helped!!!!!!!!!!
7 0
3 years ago
Why do farmers in South America get abundant crops during El Niño?
puteri [66]

Answer:

Hundreds of years ago, South American fishermen observed that every year around December or Christmas, coastal waters of the Pacific became warmer as a current flowed from north to south. This change often meant a smaller fish catch but more rainfall inland that translated to more abundant crop harvest .

Explanation:

...

4 0
3 years ago
Which of these activities increases the amount of carbon in the atmosphere?
TEA [102]

Answer:

B.

burning of fossil fuels

it increase the amount of carbon present in atmosphere.

4 0
3 years ago
Read 2 more answers
Other questions:
  • All of the elephants living in a wildlife preserve would be considered a
    9·2 answers
  • The outermost layer of earth is called the mantle t or f
    5·2 answers
  • Describe 3 observation an astronaut might make while viewing russia at night?
    10·1 answer
  • List all the organ systems
    14·1 answer
  • A major distinction between prokaryotes and eukaryotes is the presence of membrane-bound organelles in eukaryotes.
    10·1 answer
  • Help me please??????
    13·2 answers
  • if you are suffering from a cardiovascular malady the doctor might order an_____ After that you might need ______.
    7·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What are the chemical compounds of DNA?
    7·2 answers
  • The Glomar Challenger (Joides Resolution) is known mainly for: a. being the first modern scientific vessel to circumnavigate the
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!