1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
TiliK225 [7]
3 years ago
6

The cloud in interstellar dust and gas that forms a star is known as a

Biology
1 answer:
frez [133]3 years ago
8 0
A cloud in interstellar dust and gas that forms a star is known as a nebula
hope this helps:)
please mark thanks and brainliest:)
You might be interested in
Fat which has been digested is packaged in protein- and phosphorus-containing lipoproteins which travel in your lymph to your bl
Alexxandr [17]

Fat that has been digested is packaged in protein- and phosphorus-containing lipoproteins which travel from your lymph to your bloodstream. These are called chylomicrons.

<h3>What are chylomicrons?</h3>
  • Chylomicrons are large triglyceride-rich lipoproteins produced in enterocytes from dietary lipids—namely, fatty acids, and cholesterol.
  • Chylomicrons are composed of a main central lipid core that consists primarily of triglycerides, however like other lipoproteins, they carry esterified cholesterol and phospholipids.
  • Chylomicrons exit the enterocyte via the lacteals into the systemic circulation.
  • They are acted on by LPL with its cofactor Apo-CII, which cleaves off FA moieties, which in muscle and adipose tissue are immediately mobilized for energy or stored for future use.
  • So digested fat is transported through lymphatics as chylomicrons.

To learn more about Chylomicrons,

brainly.com/question/22853717

#SPJ4

3 0
2 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
All of the following are functi?
RideAnS [48]

The answer is the first option I believe.

7 0
4 years ago
Read 2 more answers
Organisms with a false coelom, like roundworms, are called _____.
aliya0001 [1]
They are called pseudocoelomats. The prefix "pseduo" means false.
3 0
3 years ago
Read 2 more answers
Which important property of DNA did Friedrich Miescher discover?
ololo11 [35]
I think it was <span>Rosalind Franklin who discovered what DNA was made up of. 
</span>James Watson and Francis Crick discovered the double helix shape of DNA and also created a 3d model of it, so it's not B nor C.
To my understanding (you should double check) the answer is D
4 0
3 years ago
Read 2 more answers
Other questions:
  • What are the two main reasons why cells divide rather than continuing to grow?
    11·1 answer
  • Which one of these helps create water pollution?
    12·2 answers
  • Which life-making function is an important part of the growth cycle?
    14·1 answer
  • Which organelle releases chemicals that break down large food particles into smaller ones?
    6·1 answer
  • How do living cells use the instructions in their DNA to perform tasks?
    14·1 answer
  • Jamie is a 24-year-old female with a urinary tract infection. She is healthy, afebrile, and her only drug allergy is sulfa, whic
    8·1 answer
  • Match each description with the correct taxonomic grouping.
    15·1 answer
  • What is the probability of a homozygous offspring? explain answer
    7·1 answer
  • Explain why a golf ball is heavier than a table-tennis ball, even though the balls are the same size
    7·1 answer
  • Part a some bacteria are resistant to erythromycin as a result of mutation of their ribosomal rna. what type of resistance does
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!