Nervous muscle action pressure
Accuracy describes how well a measuring instrument determines the variable it is measuring. How close the value is to real value. The level of accuracy of measuring tool determines the detail to which it can measure. In order to be accurate in their work scientists need first select a measuring instrument that allows an appropriate measure of accuracy and then to calibrate it. Calibrating an instrument involves measuring already known quantities to check how accurately it is. In the laboratory accuracy of a test is determined when possible comparing results from the test in question with results geenrated from an established reference method.
<span>The correct answer is d. the idea that T. rex held its tail aloft was supported by the studies of many scientists. This is how science works, things are discovered by having members of the scientific community do experiments and come to the same conclusion. Many of them confirmed this theory and a concensus was established.</span>
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
A long reflexive pathway has an advantage over a short reflexive pathway in the fact that they can be also be stimulated by the central nervous system, whereas the short reflexive pathway is only stimulated by the enteric nervous system.
