1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Strike441 [17]
3 years ago
11

Toxicologists refer to the total amount of a chemical present in the tissues of an organism as

Biology
2 answers:
Annette [7]3 years ago
8 0
Latent consequences<span>Toxicologists refer to the total amount of a chemical present in the tissues of an organism as</span>
zmey [24]3 years ago
6 0


toxicologists refer to the total amount of a chemical present in the tissues of an organism as body burden.
I hope this helps answer your question:)
You might be interested in
Given a population that contains genetic variation, what is the correct sequence of the following events under the influence of
natali 33 [55]

The correct option is (a) 2 → 4 → 1 → 3

A change occurs in the environment. → Poorly adapted individuals have decreased survivorship. → Well-adapted individuals leave more offspring than do poorly adapted individuals. → Genetic frequencies within the population change.

<h3>What is genetic variation in population?</h3>
  • The presence of various alleles, or different gene versions, within a population indicates genetic variety.
  • If there is genetic variation, then everybody in the population will have various genotypes depending on the alleles they carry.
  • Genetic loci that have many alleles are said to be polymorphic. Human characteristics like blood type and eye color, for instance, are polymorphic.

Learn more about the genetic variation with the help of the given link:

brainly.com/question/848479

#SPJ4

3 0
2 years ago
An unfertilized egg from a female Komodo dragon may develop directly into a young Komodo dragon. This is an example of
scoray [572]

asexual reproduction

One parent cell is needed

The young Komodo dragon will be a girl and look like its mother.

3 0
3 years ago
Read 2 more answers
Look at the picture the cell is going through which subphase of interphase?
Makovka662 [10]
Can I see the picture that you are talking about please
7 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
What are chemicals that have certain hallucinogenic effects on human nervous systems
masya89 [10]

Ayahuasca, DMT, LSD, mescaline, psilocybin, DXM, Ketamine , PCP, salvia.

6 0
4 years ago
Read 2 more answers
Other questions:
  • What does the term pettifogged mean ?
    13·2 answers
  • In the food chain, the grasshopper would be classified as a?
    15·2 answers
  • If the DNA sequence TGAGCCATGA is changed to TGAGCACATGA, what kind of mutation has occured?
    13·1 answer
  • When a liquid _[blank]_, the particles become _[blank]_ ordered. Which words best complete this statement?
    15·2 answers
  • A pedigree is not helpful to a counselor in predicting the probability of a recessive gene being present and the chances for an
    11·1 answer
  • What happens when a nerve impulse encounters a myelin covered section of neurn?
    6·1 answer
  • How does geologists estimation of earths age at 4.5 billion years old support evolution
    10·1 answer
  • An object has a kinetic energy of 32 J and a mass of 36 kg, how fast is the object moving?
    15·1 answer
  • Adapting the essay into a multimedia presentation can be explained as
    11·1 answer
  • What are the three differences between RNA and DNA?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!