All categories

2 years ago

I'm confused can someone help me out?

Biology

2 answers:

TEA [102]2 years ago

8 0

Answer is C. It has a birth cycle and that's how they grow.

Naddik [55]2 years ago

4 0

D. Lysogenic cycle. In this cycle, viral DNA is inserted into the host cell's DNA. It divides with mitosis, soon creating many infected host cells. Once the lytic cycle is triggered (usually from external factors), the viral DNA is transcribed/translated into viruses.

You might be interested in

What did charles darwin learn from the fossils of a giant armadillo that he found in argentina?

Korolek [52]

Modern animals may be related to fossilized organisms.

5 0

3 years ago

What are the 9 major phylum of animals. how many are invertebrates

alexgriva [62]

The eight major phyla of invertebrates are Porifera, Cnidaria, Platyhelminthes, Annelida, Most animals are invertebrates, and most of those are arthropods.

6 0

3 years ago

Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!

Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

5’-TGCCTAGGAGGGATCACGCATTATGC-3’

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

Start codon ⇒ ATG
Stop codon ⇒ TAA, TAG, TGA

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0

2 years ago

Which statement correctly identifies one advantage and one disadvantage of relying on trains for

maksim [4K]

Answer:

The correct answer is - Trains can have inconvenient schedules, but produce less pollution than cars do.

Explanation:

Trains are expensive to build and also required land for making routes and stations and platforms for passengers but that can be reimbursed by fare in a longer time period.

Trains also produce pollution but in comparison to cars these are way less contribute to the pollution, However, these are not convenient as they start and reach at a specific time and also sometimes not comfortable like cars.

8 0

3 years ago

20 POINTS!!!What describes the diet of a saprotroph?

Katena32 [7]

Answer:

Dead plant matter

Explanation:

Saprotrophs feed by a process known as absorptive nutrition, in which the nutritional substrate (e.g., dead organism or other nonliving organic matter) is directly digested by a variety of enzymes that are excreted by the saprotroph.

4 0

2 years ago