1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexdok [17]
3 years ago
9

Math the terms to the definitions

Biology
1 answer:
NNADVOKAT [17]3 years ago
5 0

Answer:

Explanation: idk bud i would help u if i knew but i dont this hurts my brain  

You might be interested in
What is the function of the diaphragm in the humans body
12345 [234]
The diaphragm is the primary muscle used in the process of inspiration, or inhalation
4 0
3 years ago
A glucose molecule is completely broken down to carbon dioxide and water in glycolysis and the citric acid cycle, but together t
Scilla [17]
It disappears from existence completely, idk. ask your teacher. hope this helps!
4 0
3 years ago
True or false: the average virus is quite large when compared with cells true or false
pashok25 [27]

Answer:

The answer is false viruses are 1/10th the size of cells

Explanation:

6 0
3 years ago
Read 2 more answers
Food,water ,and wastes are stored inside
crimeas [40]
Either trash cans aka bins or disposal places and dumps
6 0
3 years ago
Read 2 more answers
Which of the following reactions or pathways is catabolic? A) Converting glucose to carbon dioxide and water (cellular respirati
castortr0y [4]
<span>A) Converting glucose to carbon dioxide and water</span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • Help ASAP
    7·2 answers
  • In eukaryotes, glycolysis typically occurs in the _____, gluconeogenesis typically occurs in the _____
    5·1 answer
  • What are the Significance Of Helicase Enzymes During DNA replication?
    15·1 answer
  • T/F Permanent magnets can never be demagnetized.
    15·1 answer
  • Eons are the broadest category of geologic time, and we live in the Phanerozoic eon. The Phanerozoic eon is further divided into
    14·2 answers
  • Pepsinogen is produced by __________ and is activated by __________
    8·2 answers
  • Where are your hart?what you
    10·1 answer
  • Which of the following is NOT true about cells? (PLEASE ANSWER ASAP!!)
    6·1 answer
  • What are the four ways that RNA differs from DNA?
    13·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!