1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Novay_Z [31]
4 years ago
14

How do cold fronts produce winter rains in florida?

Biology
1 answer:
borishaifa [10]4 years ago
3 0
Because the cold air pushes the hot air in the atmosphere and then it comes back down and produces clouds which produce rain.
You might be interested in
In glycolysis, the isomerization of glucose to fructose is necessary because
max2010maxim [7]
"it is needed to ensure that equal 3-carbon units can be made."

One important part of the glycolysis is the metabolization of two three-carbon molecules. A glucose molecule could not be divided into two molecules. <span>
After a phosphorylation of the fructose, the molecule has now two phosphate groups. The molecule is then divided into two and the glyceraldehyde-3-phosphate (one of two) continues the chain reactions of glycolysis.</span>
6 0
4 years ago
WILL GIVE BRAINLIEST!!!!!
algol13

Answer:

A)

Explanation:

Heredity is a process in which organisms acquire characteristics from their parents. These characteristics are called traits. Every individual is unique because they have a unique set of traits. The traits which are transmitted by the parent to its offspring during the process of fertilization are inherited traits. This inheritance is determined by certain rules of heredity. Inherited traits are coded in our DNA and hence can be passed on to the next generation.

4 0
2 years ago
Read 2 more answers
In December, people in the Southern Hemisphere _____.
andrezito [222]

Answer:

The winter solstice in the Southern Hemisphere is June 20 or 21, while the summer solstice, the longest day of the year, is December 21 or 22.

So I think the answer is

<em><u>D) celebrate the summer solstice</u></em>

Happy to help

Pls mark as Brainliest

8 0
3 years ago
Read 2 more answers
Why is the human brain not considered to be a living organism
beks73 [17]
<span>Living things are described as having 8 essential characteristics. Therefore, it must have organized cells, etc. But most importantly, it must be able to reproduce. The brain in unable to reproduce, as it is only part of a living organism. :) I hope this helps.</span>
8 0
4 years ago
Read 2 more answers
The science for classifying and naming organisms is know as
riadik2000 [5.3K]
The science for classifying and naming organisms is known as the taxonomy

5 0
4 years ago
Other questions:
  • Which term best describes the movement of water molecules in and out of a cell?
    9·1 answer
  • Improper care of a thigh contusion leading to incomplete absorption of the hematoma and producing a formation similar to cartila
    10·1 answer
  • Which of the following describes how the skin of the integumentary system and the bones of the skeletal system work together in
    12·1 answer
  • During which stage of disease should an infected person be considered contagious
    6·1 answer
  • What did charles darwin mean when he said some organisms where more fit than others
    15·1 answer
  • In this food web, what is represented by the chains of arrows from the grass to the fox?
    6·2 answers
  • What is the name of the enlarged sac to which the lumbar trunks and the intestinal trunk return lymph?
    14·2 answers
  • Two types of stressors that learners are likely to experience in a post school destination as a college or university or the wor
    11·1 answer
  • NaCO3 was used as a source of carbon dioxide in the photosynthesis experiment. True False
    7·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!