1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Trava [24]
4 years ago
12

Population A is made up of living animals. The members of population B feed on these living animals. What type of relationship i

s represented by population A and B?
Biology
1 answer:
Sophie [7]4 years ago
5 0

Answer:

meow

Explanation:

fr fr

You might be interested in
Is there any one who is preparing fo medical entrance exam
Fittoniya [83]
No, I am not preparing for a medical entrance exam
3 0
4 years ago
What pattern of migration do whales follow?
ella [17]
They go straight through the ocean?
6 0
3 years ago
What is a description of cancer?
Natali [406]

Cancer: An abnormal growth of cells which tend to proliferate in an uncontrolled way and, in some cases, to metastasize (spread). Cancer is not one disease. It is a group of more than 100 different and distinctive diseases. Cancer can involve any tissue of the body and have many different forms in each body area.


im pretty  sure   it is the first one


7 0
3 years ago
Read 2 more answers
What is a fine-grained material that has been transported and deposited by the wind ?
frez [133]

Answer: Loess is the fine grained material that has been transported and deposited by the wind. The answer is <u>A.</u>

Explanation:

Since the wind can carry these types of material (find grained) father than sand, and also higher up, they are generally found very far from their original place of origin.

Loess is no larger than 50 micrometers in size. It is coarse in texture like clay, but finer than a grain of salt.

5 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Other questions:
  • The primary human source of greenhouse gases in earths atmosphere is:
    15·2 answers
  • In most primate species, males rarely participate in infant care. <br> a. True <br> b. False
    11·2 answers
  • Why do the cells in all living things need energy?
    11·2 answers
  • What property causes the cohesion of water molecules that moves water through a plant against the force of gravity?
    15·1 answer
  • can anyone Expain why it is important for Non scientists to understand how scientists use the terms Hypothesis, a guess and a th
    11·1 answer
  • As the most junior member of a lab, you are tasked with generating cell lines that accumulate DNA damage to investigate how rand
    7·1 answer
  • You may assume the Sickle Cell locus is in Hardy Weinberg equilibrium. Also, the term carrier implies that the person has a part
    10·1 answer
  • Please needed as soon as Possible thank you!
    7·1 answer
  • a __ is a hollow ball of cells that results from mitosis from within an embryo. a) blastula b) blastopore c) protostome d) duete
    12·1 answer
  • Beneficial micro-organisms that are responsible for breaking down organic matter are called?.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!