1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Whitepunk [10]
3 years ago
15

Glucagon is a hormone that signals the liver when blood sugar is low. For each of the following enzymes, indicate whether you wo

uld expect that glucagon would lead to (A) an increase, (B) a decrease or (C) have no effect on these enzymes activity in the liver.
a. Fructose- 1 ,6-bisphosphatase
b. Fructose-2,6-bisphosphatase
c.Phosphofructokinase- 1
d. Phosphofructokinase-2
e. Phosphorylase kinase
f. Glycogen phosphorylase
g. Glycogen synthase
h. Glyceraldehyde 3-phosphate dehydrogenase
i. Enolase
j. Phosphoglycerate kinase
k. Pyruvate kinase
l. Protein Phosphatase 1A
Biology
1 answer:
Leto [7]3 years ago
5 0

Answer:

a. Fructose- 1 ,6-bisphosphatase  (High)

b. Fructose-2,6-bisphosphatase  (High)

c. Phosphofructokinase- 1  (High)

d. Phosphofructokinase-2  (High)

e. Phosphorylase kinase  (Neutral)

f. Glycogen phosphorylase  (Low)

g. Glycogen synthase  (Low)

h. Glyceraldehyde 3-phosphate dehydrogenase  (High)

i. Enolase  (High)

j. Phosphoglycerate kinase  (High)

k. Pyruvate kinase  (High)

l. Protein Phosphatase 1A (Neutral)

You might be interested in
Find the word to correctly describe the action that makes a vector successful
icang [17]

Answers in order from top to bottom for statements on the left side of page.

1. Activate

2. Avoid

3. Integrate

4. Target


6 0
3 years ago
Whats the carrying capacity?
r-ruslan [8.4K]

Answer:

2003-25

Explanation:

To find carrying capacity on a graph, you need to locate the point on the graph where the population line is horizontal. Alternatively, the carrying capacity may be explicitly marked with a dotted horizontal line or a horizontal line of a different color.

7 0
3 years ago
Which would most likely cause a forced migration due to loss of habitat?
wel

Answer:

a short-term change a long-term change death adaptation. A long-term change would most likely cause a forced migration due to loss of habitat. A long-term change would most likely cause a forced migration due to loss of habitat.

Explanation:

8 0
3 years ago
Read 2 more answers
The first organism to move into an area after primary disturbance are
allochka39001 [22]

Answer: I'd say C

Explanation: Small plants are at the bottom of the ecosystem, which means they have to start it out. I'm not sure tho.

3 0
3 years ago
E)Name the force provided by the leaves of tall trees which draws<br> more water due to adhesion.
Gwar [14]

Answer:

Capillary action

Explanation:

Capillary action helps bring water up into the roots. With the help of adhesion and cohesion, water can work it's way all the way up to the branches and leaves. Read on to learn more about how this movement of water takes place.

3 0
3 years ago
Other questions:
  • Biotechnology is the same as breeding, where exchange of genetic materials is transferred from parents to offspring.
    14·1 answer
  • How do fungus reproduce
    6·2 answers
  • Which length is usually measured in micrometers?
    15·1 answer
  • Why is there more nitrogen than oxygen in the air?
    11·1 answer
  • Which is an example of a plant with true roots? <br> A) algae B) ferns C) liverworts D) moss
    11·1 answer
  • Translation is to protein as transcription is to blank
    15·1 answer
  • A fern dies and is buried beneath many layers of mud, sand, and/or soil. Many years pass, and the mud, sand, and/or soil harden
    5·2 answers
  • Describe the two different ways to measure the size of an earthquake
    10·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What results when coronary circulation is prevented in humans?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!