1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anettt [7]
3 years ago
11

Como una proteasa separa las proteínas, ¿qué se creará una vez que todo esté completamente digerido?

Biology
1 answer:
Ganezh [65]3 years ago
8 0
What asdfghjklytrewqkkk
You might be interested in
Black fur(B) in quinea pigs is dominant over white fur(b). Find the probability of a white offspring in a cross between two hete
arsen [322]

Answer:

25% D

Explanation:

3 0
3 years ago
give 2 examples of a physical response to an enviromental change that would enable an organism to maintain homeostasis
sesenic [268]
As humans sometimes experience, a cold environment can result in<span> </span>shivering<span>. This is when skeletal muscles begin to shake in small movements, creating warmth by expending energy. Humans can also sweat in high temperatures. The water on the surface of the skin is able to absorb a lot of heat during evaporation, resulting in cooling of the body.</span>
3 0
3 years ago
In living organisms, lipids are used for
tatiyna
The Answer is Quick energy.
4 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Que hacer en tiempo de soledad​
bearhunter [10]
Identifica la causa de tus sentimientos.
Acepta tus sentimientos y no luches contra ellos.
Cuéntale a alguien cómo te sientes.
Medita durante 15 minutos al día.
Deja de leer autoayuda ahora mismo.
Haz 30 minutos de ejercicio.
Conecta con gente a través de MeetUps.
Haz algo por los demás (aunque sea pequeño)
5 0
3 years ago
Other questions:
  • Which of the following is an example of an object with elastic potential energy?
    9·2 answers
  • How does offspring have a genetic variation
    12·2 answers
  • Which factor has a major effect on deepwater currents in the ocean?
    6·2 answers
  • National parks reduce the human impact on land by _______. a. permitting limited human development. b. cleaning up litter c. pre
    10·2 answers
  • Suppose a large number of dead fish are found floating in a lake. how would you determine whether they died from cultural eutrop
    10·1 answer
  • A. You are performing experiments with your protein of interest and its ligand. You are attempting to mutate the binding site of
    10·1 answer
  • How does the fermentation of pyruvic acid in cells contribute to the formation of ATP? A. It completes the oxidation of glucose
    5·2 answers
  • Help i need this its timed
    11·1 answer
  • 1. You and your classmate are discussing different organs and organ systems within the human body.
    15·1 answer
  • Which two events happen in the rock cycle
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!