1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Salsk061 [2.6K]
3 years ago
7

What will happen if the seeds are planted in the ground? ​

Biology
1 answer:
Jet001 [13]3 years ago
3 0

Answer:

a tree will grow

Explanation:

You might be interested in
Which term describes the process by which a single strand of dna serves as a template for the synthesis of an rna molecule?
Alex Ar [27]
This would be transcription.
7 0
3 years ago
If the pancreas secretes too little insulin, it results in ________. if it secretes too much insulin, it results in ________.
Montano1993 [528]

1 - Diabetes is a possible answer. When to little insulin is secreted, not enough glucose is broken down, which might cause diabetes (high blood sugar levels).


2 - Hypoglicemia. When too much insulin is secreted, all glucose will be broken down, and there will be no glucose left fot the blood (low blood sugar levels.



Hope it helped,


BioTeacher101

6 0
2 years ago
The per capita ecological footprint is the total ecological footprint for a given country or area
Phantasy [73]

The per capita ecological footprint is the total ecological footprint for a given country or area is false and is therefore denoted as option B.

<h3>What is Ecological footprint?</h3>

This is referred to as the amount of land which is required to ensure that there is adequate use and sustainability of the resources which are present in area at a given period of time.

The per capita ecological footprint is the average ecological footprint for a given country or area and not the total ecological footprint which is therefore the reason why false was chosen as the most appropriate choice.

Read more about Ecological footprint here brainly.com/question/14441911

#SPJ1

3 0
1 year ago
True or false? The buoyant force on an object depends on the yolume of the object,
oee [108]
True

The greater the object weighs (volume) the heavier it is, and it the object is heavier, the the buoyancy force will be higher

Hope this helps :)
3 0
3 years ago
Describe an experiment to investigate the effect of training on subjects ability to run faster without respire get anaerobically
Zinaida [17]
A runner HAS to use the anaerobic respiration process,first we need to know the difference between anaerobic respiration and aeorobic respiration 

<span>Anaerobic respiration is done by burning glucose directly without the presence of oxygen giving out lactic acid and energy </span>
<span>Aerobic respiration is done by burning glucose and oxygen giving out water + engergy + Co2 </span>

<span>1.) Take a stop-watch </span>
<span>2.) Take TWO or more runners </span>
<span>3.) Unlike Olympic race match ask ONE of the runners to run their fastes and the others to GRADUALLY speed up </span>
<span>4.) make the runners breath hard for air </span>
<span>5.) after finish line </span>
<span>6.) do a test of Lactic through urin test or use Lactometer (don't ask me how to use it 'cause I don't know lol) </span>
<span>7.) check the concerntration </span>
<span>8.) whoever has the LOWEST concerntration,take that runner time for running and meter to find speed you'll be able to spot out who has used aerobic respiration during the race</span>
5 0
3 years ago
Other questions:
  • An interaction in which one organism captures and feeds on another organism is called
    7·1 answer
  • How are the hardy-weinberg principles used in the analysis of codis genotypes and other strp-locus comparisons?
    7·1 answer
  • What is the symtoms of the measles
    5·1 answer
  • The nucleotide sequence encoded in a gene defines the<br><br> that make up proteins.
    6·1 answer
  • How many oxygen atoms does ozone consist of?
    9·1 answer
  • Mutations that occur in DNA sequences during replication are___
    14·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • __________ are surroundings with high levels of exposure to industrial chemicals.
    10·2 answers
  • Which pressure is associated with blood flow to organs?
    5·1 answer
  • true or false Carbohydrate-rich sports drinks should not be given to athletes during endurance sport participation because blood
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!