1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maw [93]
3 years ago
7

Explain the difference between inherited and acquired traits

Geography
2 answers:
Ahat [919]3 years ago
4 0
And acquired traits are things like the way you act or if you have attached or unattached ear lobes
Evgen [1.6K]3 years ago
3 0
Inherited is something like, blue eyes or black hair:)
You might be interested in
The major renewable resource produced in western central europe is
blsea [12.9K]
<span>The major renewable resource produced in western central Europe is hydropower</span>
5 0
2 years ago
Read 2 more answers
#12 #13 whaysfavqjaoagaavajayaavabaj
fgiga [73]
Can you take a better picture so that all of the words can be seen,maybe horizontally?
3 0
2 years ago
Those who believe that sweatshops should not be closed down point out that __________.
lesya692 [45]
Hey there

The correct answer is (D) 

(D) = <span>people work in sweatshops because it is their best alternative  

</span>Those who believe that sweatshops should not be closed down point out that <span> people work in sweatshops because it is their best alternative. 
</span>
If<span> people are poor, then </span>sweatshop labor will often<span> be </span>their<span> best option to make money for there family's. </span><span />
7 0
3 years ago
Read 2 more answers
What are the causes of poor solid waste management in your community? <br> ​
olganol [36]

Answer:

I don't have poor solid waste in my community

Explanation:

5 0
2 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
2 years ago
Other questions:
  • Which region in Georgia has the highest average temperatures?
    15·1 answer
  • The user location is usually a city.
    8·1 answer
  • What continents lie completely north of the equator?
    13·1 answer
  • Sdfghjkl;dflgiov9dc8y7sgwhdbfklop0i9ujm
    15·1 answer
  • The main physical factor that would limit agriculture on the steep slopes of the Alps would be: Select one: a. climate b. soils
    9·1 answer
  • Human resource is more important than other resources. Justify the statement
    10·1 answer
  • Explain the physical processes that occur at constructive plate margins
    15·1 answer
  • 19. Which effect is used in a turbine to convert mechanical energy into electricity? Please explain.
    10·2 answers
  • QUESTION 2
    14·2 answers
  • Why is the middle east in a still harsh war​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!