1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilya [14]
3 years ago
14

Which of these characteristics would be part of a fungus?

Biology
2 answers:
AlekseyPX3 years ago
8 0
The answer to this question is  A because all living plants have chloroplasts to use photosynthesis
vovikov84 [41]3 years ago
5 0
A. I took the test and fungus has to do photosynthesis in order to grow.
You might be interested in
What is the complementary DNA of TACCGGATGCCAGATCAAATC?
Liono4ka [1.6K]

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary <u>DNA strand</u>.

7 0
3 years ago
What type of bacteria causes environmental change
Andru [333]
The kind that messes everything up I guess
5 0
3 years ago
A plant has two organ systems: the shoot system and the root system.
alexandr1967 [171]
True.............................................................................................................................................................
7 0
4 years ago
Read 2 more answers
For earlobes only, how many students in your class do you think will share the same form (free or attached) as you?
zvonat [6]

Answer:

sometimes

Explanation:

it all dependes on something

5 0
2 years ago
If 34 percent of the bases in a DNA molecule are adenines, then which of the
Lyrx [107]

Answer:

34 percent of the bases have to be thymine

3 0
3 years ago
Read 2 more answers
Other questions:
  • What are the main points of the cell theory of life
    10·1 answer
  • A preschooler's mother was exposed to cats during her pregnancy, and the child has toxoplasmosis. which influence on development
    10·1 answer
  • Which characteristics describe the genetic code of humans?
    12·1 answer
  • During cell replication, an error may result in a base pair substitution. Which of these terms describes the change in the base
    13·2 answers
  • Should the united states require food producers to label foods containing gmos
    9·2 answers
  • Consider the following statements:
    8·1 answer
  • What is the role of a protein channel in transport?
    8·1 answer
  • Cytosine makes up 30% of the nucleotides in a sample of DNA from an organism. Approximately, what percentage of the nucleotides
    11·1 answer
  • 2. a protein that catalyzes (speeds up) a reaction without being changed by the?
    8·2 answers
  • Which meal is high in fiber, low in saturated fats, and high in unsaturated fats? a) beef, potatoes, and carrots
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!