1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sertanlavr [38]
3 years ago
12

5. What are common uses of epidemiology?

Biology
1 answer:
Effectus [21]3 years ago
4 0

Answer:

It is the scientific method of investigation problem-solving used by disease detectives like epidemiologists, laboratory scientists, statisticians, physicians and other health care providers, and public health professionals, to get to the root of health problems and outbreaks in a community.

Explanation:

You might be interested in
Temperature is an important physical feature of an ecosystem. which option below shows a correct, direct relationship between te
vovikov84 [41]
The answer is E. Arctic temperatures are increasing; the arctic fox is hibernating for longer periods of time.

Since the temperatures are increasing, Winter becomes longer, giving organisms a longer time to hibernate. Hope I helped :)
3 0
3 years ago
9. When water is ejected from the earth's interior in the form of hot water, it is called
Nadusha1986 [10]

Answer:

i believe the answers are A) geyser  and c)25%

Explanation:

3 0
3 years ago
Help with this question
galben [10]
Your answer is D (4)
I hope i helped
Please mark brainliest :) 
Peace
6 0
3 years ago
MRNA Molecule<br> AUGAACCAUUCAGUAUGG<br><br> what is the Amino Acid
Vinil7 [7]

Answer:

amino acids are organic compunds.....

6 0
3 years ago
Read 2 more answers
How does DNA code for traits
trasher [3.6K]

The sequence of nucleotides in DNA genes determines the order of amino acids in a protein. This is the direct connection between your genes and your traits. The mechanism is a two-step process. First an enzyme transcribes a gene to an intermediate biochemical called ribonucleic acid, or RNA.

3 0
3 years ago
Other questions:
  • The client receives hydrocortisone thrapy. the nurse will primarily assess for which electrolyte disturbances
    5·1 answer
  • Relationship between probability and genetics
    9·1 answer
  • "Which statement concerning the oxygen level in the lake can be inferred from the graphs?
    9·1 answer
  • I’m stuck! Please help
    15·1 answer
  • Carbohydrates<br> act as "ID<br> cards" for cells.<br> Where are they<br> located?
    8·2 answers
  • What is not a cause of melanoma
    5·1 answer
  • PLZ PLZ PLZ HELP WILL MARK BRAINLIST In a short paragraph (2-4 sentences), EXPLAIN how seafloor spreading occurs and how it rela
    7·1 answer
  • A species that lacks adaptation to a changing environment is more likely <br> to
    6·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Drag the tiles to the correct boxes to complete the pairs. what do the variables in the hardy-weinberg equation represent? p p2
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!