1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OLga [1]
4 years ago
10

Why copes ideas about the evolution of tetrapods were considered a hypothesis and not a theory

Biology
1 answer:
Butoxors [25]4 years ago
8 0

Cope's Rule postulates that animal groups tend to evolve through time towards larger body size. Even though larger body size is often advantageous trait it isn’t always that way (larger organisms require greater amount of food, and can have problems when food is sparse).  

But this postulate isn’t theory, because body size increase through time, but the mean body size often doesn’t.


You might be interested in
The digestive juices from the liver are delivered to the ________.
tankabanditka [31]

Answer:  The liver

Explanation:

The liver produces a digestive juice called bile. The gallbladder stores bile between meals. When a person eats, the gallbladder squeezes bile through the bile ducts, which connect the gallbladder and liver to the small intestine.

:)

6 0
3 years ago
Read 2 more answers
Endocrine glands are responsible for
koban [17]
Endocrine glands are responsible for <span>regulating body activities. The correct option among all the options that are given in the question is the second option or option "B". The endocrine system basically acts as long distance signalling system for the body. I hope that the answer has helped you.</span>
6 0
3 years ago
The term "genetic code is defined as the sequence of bases in DNA in a cell's nucleus. The types of bases in the genetic code ar
VikaD [51]

Answer:

amino acid because genetic code sequences of bases in DNA

7 0
3 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Qué nivel ocupa el ser humano. ¿Es consumidor o productor?
miv72 [106K]
El ser humano se encuentra en los niveles tróficos correspondientes a los consumidores, específicamente, un omnívoro -capaz de consumir tanto vegetales como carne- por lo que ubicarlo en un nivel trófico resulta complicado.Nov 7, 2016
5 0
3 years ago
Other questions:
  • Which situation would lead the client's family to suspect onset of dementia?
    10·1 answer
  • What are the terminal branches of the highlighted artery? What are the terminal branches of the highlighted artery? cephalic and
    9·1 answer
  • What is demand for supply​
    7·2 answers
  • When water forms from hydrogen and oxygen water is the
    12·1 answer
  • Which one is the right choice?
    13·1 answer
  • ⚠️⚠️⚠️Students in a science class were asked to investigate how missing or damaged
    7·1 answer
  • Which parts of the water cycle require energy from the sun?
    13·2 answers
  • How does energy change when two objects collide? Think about how potential and kinetic energy work, Explain HELP PLZz!!​
    8·2 answers
  • The stage of the demographic transition that shows the most population growth is the
    8·1 answer
  • Class 10 bio notes of chapter our environment​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!