Answer:
Cone cells, or cones, are photoreceptor cells in the retinas of vertebrate eyes (e.g. the human eye). They respond differently to light of different or color vision and function best in relatively bright light, as opposed to rod cells, which work better in dim light. Cones are mostly in the center of your retina. They help you see color and fine detail.
Explanation:
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
Ribosomal RNA: Structural part of ribosomes
Messenger RNA: Carry genetic information from DNA to proteins
Transfer RNA (tRNA): Transport amino acids to protein synthesizing complex.
Explanation:
Ribosomes are made up of ribosomal RNA (rRNA) and proteins. The catalytic activity for the formation of peptide bonds between amino acids during protein synthesis resides the RNA of ribosomes.
Messenger RNA (mRNA) is formed by the process of transcription during which the nucleotide sequence of the template DNA strand is copied into that of the RNA. The mRNA serves as a template for protein synthesis. The nucleotide sequence of mRNA is read in the form of genetic codes to specify the amino acid sequence of a protein. In this way, the genetic information stored in DNA is carried to the proteins.
During the process of protein synthesis, tRNAs carry amino acids to the mRNA-ribosome complex so that the amino acids are incorporated into the polypeptide. For the purpose, there is a tRNA with a specific anticodon sequence for a particular amino acid.
Answer:
Parallel Evolution
Explanation:
It is because only three members are normal while one of them has a rare recessive allele. Due to parallel evolution, the recessive allele will now become common as the other previously distinguished dominant alleles and now all the traits will be in a uniform equilibrium according to Hardy-Weinberg Theorem.
Food is mixed with protease is the correct answer. Hope this helps :)
