1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Masteriza [31]
3 years ago
13

Which quantity and unit are correctly paired?

Biology
1 answer:
lutik1710 [3]3 years ago
8 0
SI units are the standard units that are recommended by the IUPAC. The units of velocity is m/s since it is given by dividing displacement (m) and time (s).
Momentum is the product of velocity (m/s) and the mass(kg) of a body, thus its units are kgm/s. Work is given by the product of force (N) and distance (m), thus its units are Ns or Joules. Energy is measured in kg m²/s². Hence the correct answer is 3
You might be interested in
Gas exchange that occurs in the alveoli-capillary membrane is referred to as what type of respiration
natta225 [31]

We can confirm that one classification often used to describe the gas exchange that occurs in the alveoli-capillary membrane is external respiration.

<h3>What is external respiration?</h3>

This is a term used to describe the gas exchange that occurs in the alveoli-capillary membrane, where oxygen is received and carbon dioxide is released from the body. On the other hand, internal respiration is when the oxygen reaches the organs and tissues and another exchange of gasses takes place.

Therefore, we can confirm that one classification often used to describe the gas exchange that occurs in the alveoli-capillary membrane is external respiration.

To learn more about respiration visit:

brainly.com/question/1439976?referrer=searchResults

4 0
3 years ago
Describe what happens in the nervous system when you duck your head to avoid an object flying toward it. 2. what protects the br
Ronch [10]
The bone protect everything from injuries
4 0
3 years ago
What happens during the process of cellular respiration? <br> edge nuity
mrs_skeptik [129]

Answer:

sourced from wiki

Explanation:

Cellular respiration is a set of metabolic reactions and processes that take place in the cells of organisms to convert chemical energy from oxygen molecules or nutrients into adenosine triphosphate (ATP), and then release waste products.

3 0
3 years ago
Ideally, sustainable development should
Lana71 [14]
<span>Ideally, sustainable development should preserve the environment and ecosystems while being continually implemented. For example, solar energy is sutainable because you can't spend it by using it. Oil is unsustainable becasue it will run out and you can't replenish it in time. Wind energy is also sustainable.</span>
7 0
4 years ago
Plant needles are PROBABLY initially the result of A) adaptations for survival that some plants developed due to high temperatur
nydimaria [60]
D)  <em><u>a beneficial mutation that increased survival of certain plants that reproduced and passed the mutated gene to offspring.

Hope this helped! xD</u></em>
5 0
3 years ago
Read 2 more answers
Other questions:
  • The _ gives instructions for producing a protein
    5·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • How can citizens protect civil liberties?
    14·2 answers
  • Maria would like to determine how mixing two solutions that chemically react with each other affects the density of the solution
    7·2 answers
  • A freshwater fish regulate its salt levels by pumping salt outward across its gills true or false?
    13·2 answers
  • Which statement best explains he relationship between hbs allele frequency and malaria
    8·1 answer
  • The National Center for Policy Analysis released a newsletter in June 2009
    10·1 answer
  • The diagram below shows a single celled alga which lives in fresh water.<br> Please help
    5·1 answer
  • What are some random things that you’re too anxious to ask??
    8·2 answers
  • A series of amino acids linked in linear<br> fashion is called a
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!