1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Colt1911 [192]
3 years ago
14

How can citizens protect civil liberties?

Biology
2 answers:
Snowcat [4.5K]3 years ago
5 0
Civil liberties protect us from government power. They are rooted in the Bill of Rights, which limits the powers of the federal government. The government cannot take away the freedoms outlined in the Bill of Rights, and any action that encroaches on these liberties is illegal.
Here you go :)
tiny-mole [99]3 years ago
3 0
Authorizing the indefinite incarceration of non-citizens based on mere suspicion, and the indefinite incarceration of citizens designated as "enemy combatants" without access to counsel or meaningful recourse to the federal courts;

(b) limiting the traditional authority of federal courts to curb law enforcement abuse of electronic surveillance in anti-terrorism investigations and ordinary criminal investigations;

(c) expanding the authority of federal agents to conduct so-called "sneak and peek" or "black bag" searches, in which the subject of the search warrant is unaware that his property has been searched;

(d) granting law enforcement and intelligence agencies broad access to personal medical, financial, library and education records with little if any judicial oversight;

(e) chilling constitutionally protected speech through overbroad definitions of "terrorism";
You might be interested in
What's a question that could be answered by observing chromosomes of different species of animals
V125BC [204]
1. what clue  to the presence of certain genetic disorders can be seen in  karyotype?                                                                                                               2. why might a lab worker attempting to diagnose a genetic disorder prefer to work with photographs of  chromosomes rather than the chromosome themselves?                                                                                                             3.why would it be much difficult to construct a karyotype of unstained chromosomes?                                                                                                    
5 0
3 years ago
Read 2 more answers
Is there a relationship between crystal size and intrusive rocks
Grace [21]
Yes, if a rock is intrusive, it has large crystals.  
5 0
3 years ago
A yellow fever mosquito has 3 chromosomes in its eggs. how many chromosomes does it have in its wing cells
sesenic [268]
<span>It have 18 chromosomes in its eggs. Because it has 6 chromosomes in each somatic cells. So 6 x 3 = 18 chromosomes. This is because the mosquito received 3 chromosomes from its mother and 3 chromosomes also from its father making up 6 chromosomes.</span>
7 0
3 years ago
Give an example of a stimulus, and explain how your nervous system and muscular system work together to respond to it. Explain i
kvasek [131]

Answer:

Hot metal.

Explanation:

Hot metal is the stimulus that allows nervous system and muscular system work together. When the person touch the hot metal, the sensory cells present on the skin sends signals to the central nervous system through sensory neurons. The central nervous system made a decision and order to the muscles of the hand to remove hand from the hot metal or body. These orders are send to the muscles through motor neurons. In this way, both nervous system and muscular system work together.

3 0
3 years ago
A farmer uses genetic engineering to inject dairy cows with a genetically altered hormone (GAH) to result in the production of m
Nitella [24]

Answer:

B

Explanation:

6 0
3 years ago
Other questions:
  • Which term refers to the thick folds of tissue found on each of the cerebral hemispheres?
    6·1 answer
  • Where the ocean would you expect to find the largest % of dissolved gases ?
    15·1 answer
  • Bats, birds, and humans are vertebrates. Birds and bats have wings that help them fly, and humans don’t have wings. But if you l
    13·2 answers
  • Which of the following is an example of an abiotic factor?
    7·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Which best describes a bird’s role as it eats seeds?
    7·2 answers
  • In eukaryotic cells, the genetic structure consists of DNA and a tightly wound protein, which together form a substance called _
    11·1 answer
  • SECTION B<br>1. Define the following terms<br>a.copulation​
    7·1 answer
  • A bud forms on what part(s) of the plants during vegetative reproduction?
    13·1 answer
  • Which two atoms form an ionic bond?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!