1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yulyashka [42]
3 years ago
12

How do regulatory proteins of the cell cycle help maintain homeostasis? the regulatory proteins control the cycle by signaling t

he cell to either or delay the next phase of the cycle. it seems that the proteins act as transporters in the homeostasis process.
Biology
2 answers:
harina [27]3 years ago
6 0

Answer:

The regulatory proteins control the cycle by signaling the cell to either or delay the next phase of the cycle.

Explanation:

Cell cycle regulatory proteins help maintain homeostasis because they control the cycle by signaling the cell to or delay the next phase of the cycle. Thus these proteins prevent the imbalance of molecules in the body and as we know homeostasis seeks to maintain balance in the body.

The cell cycle can stop at certain points and only advance if certain conditions are met, such as the presence of an adequate amount of nutrients, when the cell reaches certain dimensions, or when the cell needs to delay or stop a certain phase of a metabolic process. The regulation of the cell cycle is done through the regulatory proteins.

emmainna [20.7K]3 years ago
3 0
I think the correct answer from the choices listed above is the first option. Regulatory proteins of the cell cycle help maintain homeostasis by controlling <span>the cycle by signaling the cell to either or delay the next phase of the cycle. Hope this answers the question.</span> 
You might be interested in
Plate tectonics is driven by moving within the asthenosphere
juin [17]
What do you mean by this question
3 0
3 years ago
What overarching statement best describes what is being studied? What general statement includes what is being studied? It's abo
IrinaK [193]
<span>Here is an essay I wrote on renewable energy feel free to use some of it:
</span><span>Solar power:1. The definition of solar power is power obtained by harnessing the energy of the sun's rays.2. Using solar power can be better for the environment than coal. It is local.3. Solar power can be very expensive. There isn’t always sun, so we can not always get power from this resource.4. Solar power plants take up land often resulting in habitat loss, and some use hazardous materials in making solar power panels.5. Using this resource is better for the environment than using coal, but since there isn’t always sun, we can not always get power from this resource.6. Solar power cost more to create and to use than coal does.
7. Photovoltaics (PV) and concentrated solar power (CSP) are used to collect energy from the sun.
8. The sun hits the solar panels and generates DC electricity. The energy then goes into a solar inverter that turns the DC energy into AC energy, which is then used to power things.
9. Two potential hazards in using this resource are the materials used to make it, and habitat loss.
10. If solar power were our primary way of getting electricity a lot of land would be taken up by the solar power plants, resulting in the loss of a lot of animal habitats. Also, the sun isn’t out 24/7, so we can not always get power from this resource.<span>
</span></span><span>Since I believe that our country is already headed in this direction anyway, I would suggest that we invest in the use of more renewable resources. I would suggest that we use geothermal as our main way to get our hot water for our homes, hydropower for electricity in states with an abundant water supply, and the combination of wind and solar power for electricity as well. I think we would have cleaner air and it would be more efficient. Both renewable and non-renewable have their pros and cons, and I personally believe that in this day and age we would have a hard time functioning without both of them. But I do think that using more renewable resources would be a good investment.</span>
3 0
3 years ago
Mrs. Jones who has dementia. She continues to ask for her husband, whom you know passed away several years ago. How would you as
wlad13 [49]

Answer:

You tell her that her husband is away and will be coming back later

Explanation:

If you tell her he's dead, she won't believe you so just go along with it.

3 0
2 years ago
Has all the matter and energy in the universe always existed or are completely new
Nookie1986 [14]

Answer:

no

Explanation:

matter can neither be created nor destroyed so all matter is reused

5 0
2 years ago
Glass plate which the specimen is placed on
scoundrel [369]
Its called a microscope slide
4 0
3 years ago
Other questions:
  • Which of the following statements supports the one gene-one enzyme hypothesis?
    7·1 answer
  • What is the name of the structure that connects the arteriole and venule sides of a capillary bed?
    12·1 answer
  • What was Anton van leeuwenhoek’s contribution in the devolopment of cell theory?
    8·2 answers
  • Hubble's expansion law states _____.
    11·1 answer
  • The presence of nitrogen-fixing plants should benefit nearby individuals of other species, because nitrogen is a key nutrient--i
    14·1 answer
  • How did the United States acquire the Panama Canal?
    10·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Marianne is comparing two animals: a fruit fly and a fruit bat. She asks, "Do a fruit fly and a fruit bat share a common ancesto
    12·1 answer
  • What do conduction and convection have in common?
    11·1 answer
  • The hantavirus outbreaks in the eastern hemisphere (asia) are identified with pulmonary failure, and have been referred to as "h
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!