1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
castortr0y [4]
3 years ago
13

Under what conditions is a rock more likely to deform plastically than to break?

Biology
1 answer:
Likurg_2 [28]3 years ago
5 0

At the Earth's surface, rocks usually break quite quickly, but deeper in the crust, where temperatures and pressures are higher, rocks are more likely to deform plastically. Sudden stress, such as a hit with a hammer, is more likely to make a rock break. Stress applied over time often leads to plastic deformation. Hope this helps. ヅ

You might be interested in
All organisms on Earth have_______that are made of DNA and function in a similar way.
elena-s [515]

Answer:

Every living things is made up of cells.

Explanation:

6 0
2 years ago
Read 2 more answers
Which of the following is a nonrenewable resource?
NARA [144]
I think is a.geothermal
8 0
3 years ago
Read 2 more answers
Which never affects the moons phase?
ella [17]
I believe the answer is
<span>-The earths rotation on its axis</span>
5 0
3 years ago
You are monitoring Birch Lake,
scoray [572]

A. Snails and crayfish would not survive in Birch Lake at a pH of 6.2.

B. Once they die out, the walleye will disappear as well.

4 0
3 years ago
Name the parts of the cell.
Katarina [22]

Answer:

A. Nucleus

B. Cell membrane

C. Vacoule

D. Mitochondria

Explanation:

if it help you

Mark as brainleist

3 0
3 years ago
Other questions:
  • The population that is experiencing exponential growth this means it is growing___then___
    6·1 answer
  • Sometimes characteristics are not heritable but are environmentally influenced. describe three characteristics that are not inhe
    8·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Select the correct answer from the drop-down menu. Why is environmental science important ?
    14·1 answer
  • Which of the following caused the United States to enact the Embargo Act?
    6·1 answer
  • Select all that apply.
    6·2 answers
  • Glycerophospholipids have ________ heads and long ________ fatty acid tails.
    11·1 answer
  • Pls help i dont understand :( will give Brainliest + 25 points!!
    14·2 answers
  • What is a macromolecule?
    11·2 answers
  • Explain how cactus leaves and stems might have changed through the process of natural selection
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!