1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svetoff [14.1K]
3 years ago
11

What is a stimulant used for constipation

Biology
2 answers:
OverLord2011 [107]3 years ago
6 0
The answer is most likely of all to be c.
lisabon 2012 [21]3 years ago
5 0
I think the answer is B
You might be interested in
What Adaptations do Barracuda's have?
11111nata11111 [884]
They have very sharp teeth to cut through their prey, or try to escape if they are trapped
Their bodies are very narrow, enabling them to be very quick and nimble, it also enables them to hide it tight spaces

Their teeth also enables them to escape a fishermen's line ( I'm a fishermen and I've lost many barracuda due to those teeth.)

I hope this helped
4 0
3 years ago
You played hard in Pe today and didn’t get a chance to rehydrate after class. You fell tired and sluggish. How does your body re
olya-2409 [2.1K]

Answer:

  1. Respiratory system
  2. Nervous system
  3. Circulatory system
  4. Integumentary system
  5. Endocrine system

Explanation:

During excessive hard work or sports, the respiratory system acts to provide sufficient oxygen for energy supply (ATP) - a process takes place in mitochondria. At the very beginning, the respiratory system is active. If the person doesn't intake sufficient water, he will feel tired because of heavy breathing that increases body temperature and affects metabolic reactions. A supply of water would help decrease the respiration need and so support other systems.

The nervous system (hypothalamus) regulates the body temperature which is necessary for metabolic reactions taking place within the body, i.e. homeostasis. During and after exercise, the water intake was not sufficient, this means that the hypothalamus would work to maintain the temperature as well as other metabolic mechanisms. In the case of less water intake, the nervous system would be in stress.

The circulatory system acts to transport blood and oxygen to all parts of the body. During sports activities, the oxygen supply would be high to maintain energy supply. This takes place with the combined action of the circulatory system and respiratory system. For optimal functioning, the circulatory system needs fluids (water) intake because sufficient water is already lost during sports.

The integumentary system is the system that directly protects the body from damages including dehydration. Therefore, in this case, it will be highly active.

The endocrine system consists of glands that produce hormones to control body metabolism. The body metabolism, as mentioned before, is driven through water availability. The reduced water in the body would also put the endocrine system under pressure.

6 0
2 years ago
Which is the best description for why skeletal muscle stores glycogen
gayaneshka [121]

Answer: Skeletal muscle is a heavy consumer of energy.

3 0
2 years ago
1. A group of scientists proposes an idea that a chemical compound will enable bean plants to grow faster. They grow one group o
Paladinen [302]
C. data analysis.

I just took a test with this exact question and c was the correct answer
5 0
3 years ago
Read 2 more answers
What is a trait that is ancestral to all chordates?
tester [92]
<span>chordates are the animals which are in phylum chordata and have backbone
</span>The  trait that is ancestral to all chordates is <span>a vertebral column that is backbone
so option D is correct
hope it helps</span>
4 0
3 years ago
Read 2 more answers
Other questions:
  • Mandatory labeling of foods is regulated by the ________.
    14·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • How are genes and alleles related to genotypes and phenotype ?
    8·1 answer
  • Which of the following is likely abiotic limiting factor of fish in a pond ecosystem? pollution
    11·2 answers
  • How do cells maintain homeostasis using active transport
    10·1 answer
  • Question 6
    10·1 answer
  • Which of the following statements is (are) FALSE? I. Vertebrate blood is a type of connective tissue. II. Plasma is composed mai
    5·2 answers
  • What can be transferred between objects?
    9·2 answers
  • How do solar radiation effect the climate
    6·1 answer
  • Imagine that you have separated the cells of different sponges and mixed them up in a lab. Describe the experiment and your pred
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!