It’s B, having variation from sexual reproduction because the two parent mix genetic information so they have more of an advantage
Answer:
Extraction of oil from tar sands is not economically feasible.
Explanation:
Answer:
The acidity level of water is measured by the pH scale. Pure water has a pH of 7, which is neutral. However, natural rainwater actually has a pH of 5.6 because it gets exposed to the gases in the atmosphere, making it a bit acidic. True acid rain will have a pH level measuring from 5.0-5.5.
Lift heavy, eat a lot, just don’t eat a lot of BAD stuff.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
