1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NNADVOKAT [17]
3 years ago
14

Change 3/11 to a decimal

Mathematics
2 answers:
inysia [295]3 years ago
6 0
To change a fraction to a decimal , you just divide the number on top by the number on the bottom.
So to change 3/11 to a decimal you divide 3 by 11 and you get  0.272727
= 3/11

= 3 ÷ 11

<span>= 0.272727
</span>
you can round this to 0.273
erastova [34]3 years ago
3 0
Divide three by 11 and u get an answer but round that and it is 0.27
You might be interested in
I need help can someone help
zaharov [31]

Answer:

yes i can but will have to get back to you in about half a hour just doing maths atm with the teacher

Step-by-step explanation:

4 0
3 years ago
Which of the following is the best estimate of the direction of the given vector?
notka56 [123]

Answer:

The direction of the given vector is 45° N of W

Step-by-step explanation:

* Lets revise the four directions with the four quadrants

- The four directions are:

# North which represented by the positive part of y-axis

# South which represented by the negative part of y-axis

# East which represented by the positive part of x-axis

# West which represented by the negative part of y-axis

∴ The first quadrant is between the East and the North

∴ The second quadrant is between the West and the North

∴ The third quadrant is between the West and the South

∴ The fourth quadrant is between the East and the South

* The direction of any vector is tan Ф, where Ф is the angle between

 the vector and the x-axis, then:

- The direction of North of East is 45° ⇒ first quadrant

- The direction of North of West is 45° ⇒ second quadrant

- The direction of South of West is 45° ⇒ third quadrant

- The direction of South of East is 45° ⇒ fourth quadrant

* Now lets solve the problem

∵ The direction of the vector is between the North and the West

  (its vertex in the second quadrant)

∴ Its direction is 45° North of West

* The direction of the given vector is 45° N of W

7 0
3 years ago
Use the Pythagorean Theorem to find the missing length and then round the result to the nearest tenth.
motikmotik
A^2+B^3=c^2
6^2+8^2=c^2
36+16=c^2
52=c^2
Square root both sides
7.2=C
6 0
3 years ago
What is the first consecutive even integer that follows -6
Gnoma [55]
-4 is the first consecutive even integer following -6<span />
8 0
3 years ago
Read 2 more answers
What is the value of. X in this equation<br><br> 1.54x+6.814=8.2
sveticcg [70]

Answer:

x=0.9

Step-by-step explanation:

1. You first have to isolate the x term so you subtract 6.814 from both sides which makes the equation 1.54x=1.386

2. Then, to isolate "x", you divide 1.54 on both sides to get rid of the 1.54 which makes x=.9

5 0
3 years ago
Other questions:
  • Which ratio correctly compares 3 yards to 27 feet, when the lengths are written using the same units?
    10·2 answers
  • What do you think the answer is, please hurry.
    15·1 answer
  • Subtract.<br> 4/5 - 1/4 = <br><br> plz hellllllllllp
    8·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • HURRY PLEASE!!!!!!!<br><br> What is the argument of z = 1/16 - square root of 3/16 i?
    13·2 answers
  • What is the slope of the line if one point is (-2,1) and (1,4)
    14·1 answer
  • 2(3v−5)=2(v−11)−4<br> what is v?
    11·1 answer
  • A scientist uses 20 grams of carbon every 10 minutes during an experiment. If the experiment lasted 2 hours, how many total kilo
    8·2 answers
  • Please HELP ME NOW HURRY ASASAP !!!
    8·1 answer
  • Write in the measure, in degrees, for each angle marked with a question mark.​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!