1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Levart [38]
3 years ago
6

1. what do chemical bonds help an organism with?

Biology
1 answer:
MariettaO [177]3 years ago
8 0
Idkgdhsjjshsysdtsdtsysgdddhdhdhhd
You might be interested in
Interferons are cytokines produced by host cells in response to intracellular infection. There are two types of interferons, typ
yan [13]

Answer:

A. Type I is part of innate, nonspecific immunity, while type II is part of adaptive, specific immunity.

Explanation:

Type I interferons: Are produced early on during infection and are responsible for activation of the innate immune response, e.g Natural Killer cells.

Type II interferons: Are produced as part of the innate immune response and act as a link between innate immune response and activation of the adaptive immune response.  

5 0
4 years ago
What causes the softening of the cell wall and the breaking of sugars?
masha68 [24]

Ethylene

Explanation:

Introduction

The growth and development of plants under varied environmental conditions determine agricultural production. The growth, development, and senescence of plant’s organs can influence crop production by modulating photosynthesis, nutrient remobilization efficiency, and harvest index (Paltridge et al., 1984; Jing et al., 2005; Iqbal et al., 2012). Phytohormones have been shown to increase growth and yield of plants. The phytohormone ethylene controls growth and senescence of plants (Reid, 1995; Lutts et al., 1996; Thompson et al., 1998; Pierik et al., 2006; Masood et al., 2012; Nazar et al., 2014). Ethylene is regarded as a multifunctional phytohormone that regulates both growth, and senescence. It promotes or inhibits growth and senescence processes depending on its concentration, timing of application, and the plant cell

4 0
3 years ago
Fungi do NOT
ExtremeBDS [4]
The correct answer is:
A. carry out photosynthesis
6 0
3 years ago
Which two statements summarize a way that a self-feeder gets food?
Leona [35]

Answer:

B. Sphagnum moss takes in energy from sunlight.

D. Euglenas carry out photosynthesis.

Explanation:

According to the question, "a self-feeder" means an autotrophic organism i.e. an organism that produces or obtains food by itself. The process by which an autotrophic organism obtains food is referred to as PHOTOSYNTHESIS. Photosynthesis entails the synthesis of food in form of organic compounds in the presence of sunlight.

Based on this, Euglenas, which is a plant-like protist, carrying out photosynthesis and Sphagnum moss, which is a lower plant (bryophyte) taking in energy from sunlight in order to perform photosynthesis are two examples that describes a "self-feeder"

4 0
3 years ago
What is one factor that makes women more susceptible than men to urinary tract infections?​?
lubasha [3.4K]
One  of  the  factor  that  make  women   more  susceptible  than  men  to  urinary  tract  infection  is  because  male  have   longer   urethra  while  female  have  shorter  urethra.this  make  infectious  agent  to  reach  the bladder  more  easily  through   the  short  female  urethra  than  through  the  longer  male  urethra.women   are  affected 50-60  times  as  often  to  men
8 0
3 years ago
Other questions:
  • Need help with the last one
    7·1 answer
  • What are the five properties of an enzyme?
    12·2 answers
  • What is the correct sequence of factors involved in blood clotting?
    14·2 answers
  • Identify the correct statements about ribosomes. Prokaryotes have 70S ribosomes, while Eukaryotes have 90S ribosomes Prokaryotes
    9·1 answer
  • Which animal adapts in goa​
    9·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Please help asap<br> True or False: Lipids are NOT true macromolecules.
    8·1 answer
  • What biosafety levels do most introductory microbiology students work with.
    11·1 answer
  • Explain the process of photosynthesis ​
    9·1 answer
  • What is the biotic of the oceanic zone?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!