1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ddd [48]
3 years ago
7

#4 and #5 please 20 points

Biology
1 answer:
Brut [27]3 years ago
5 0
I did this quite a while ago so I forgot a bit of studf. Sorry if I am not precise enough.

I only could get 4

If u do the square thing, it will be 25% to, 25% TT, and 50% Tt.
You might be interested in
Jeremy's trainer should have taken a physiology class. If he had, he would know that the use of steroids (in addition to other p
Natasha2012 [34]

The answer is Parathyroid Hormone (PTH). Steroids reduce calcium levels in the blood. This results in activation of the parathyroid hormone that is essential in the metabolism of calcium in the blood. PTH induces reabsorption of calcium from bones to restore homeostasis Ca2+ levels in the blood hence causing osteoporosis. Osteoporosis causes an increased risk of bone fractures.


3 0
3 years ago
How are rivers made ?
Kay [80]

Answer:

Rivers usually begin in upland areas, when rain falls on high ground and begins to flow downhill. They always flow downhill because of gravity. They then flow across the land - meandering - or going around objects such as hills or large rocks.

Explanation:

Hope this helps!

8 0
3 years ago
Read 2 more answers
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
2 years ago
When elements combine to form compounds what happens to the properties of the original elements?
exis [7]
The properties of the original elements are completely changed.

For example, in the compound called "iron(II) sulphide", it is composed of iron and sulphur, that are chemically combined together. The element iron is attracted to magnets. Meanwhile, iron(II) sulphide is not attracted to magnets. 

Another example is where sulphur has a yellow colour, but iron(II) sulphide has a brownish colour. As we can see, even the physical properties (colours) are completely different.

Therefore, the properties of the original elements are completely changed when they're combined into compounds.





3 0
2 years ago
What time is it in Pottstown at the time of the map?
Sladkaya [172]
The Current Time in
Pottstown, Pennsylvania is:

<span>Friday
12/2/2016
8:36 AM
EST

Pottstown, Pennsylvania
is in the
Eastern Time Zone

Hope this helps

</span>
7 0
2 years ago
Other questions:
  • Which of the following is true about competition? *
    10·1 answer
  • Which complication is a primipara with a second-degree laceration and repair most likely to experience during the postpartum per
    8·1 answer
  • Glucose is stored in ____ within the cell.
    10·2 answers
  • Which plant-cell organelle supports and maintains the cell's shape and protects the cell from damage?
    13·2 answers
  • HELPPPPPPPPPPPPPP PLSSSSSSSSSSSSSS
    6·1 answer
  • Write in your own words | 50 points | will mark brainliest
    6·1 answer
  • Asswelll with thissssss please
    9·1 answer
  • How do the oak forest ecological pyramids differ from other examples of ecological pyramids within an
    11·1 answer
  • Match the behavior type with the corresponding action.
    15·1 answer
  • Does the Russian-Ukrainian war have an effect on the US Economy?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!