1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sholpan [36]
3 years ago
8

Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG

Biology
1 answer:
trapecia [35]3 years ago
7 0

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

You might be interested in
A stable ecosystem is characterized by having
guajiro [1.7K]
A stable ecosystem is characterized by having a continual input of energy from the sun. This is required in order to sustain or maintain a stable structure. Without proper supply of energy, life would not exist. Hope this answers the question.
7 0
4 years ago
Earth's ______ causes the Coriolis effect.<br> •winds<br> •rotation<br> •temperatures
Sholpan [36]

  • B) Rotation

\:  \:  \:

Earth's rotation causes the Coriolis effect.

\:  \:  \:

\:  \:  \:

\:  \:  \:

\:  \:

Hope Helps `~~

6 0
3 years ago
Read 2 more answers
Please help thank you
shusha [124]
The correct answer is A
8 0
3 years ago
Which of the following is an example of a solution?
Elina [12.6K]

Answer:

bleach (sodium hypocrite dissolved in water)carbonated beverages (carbon dioxide dissolved in water is what gives sodas their fizz)

Explantion: A solution is a mixture of one substance dissolved in another so the properties are the same throughout

  1. The atmosphere is a good example of a solution in which a gaseous solvent (nitrogen) dissolves other gases (such as oxygen, carbon dioxide, water vapor, and neon).
3 0
4 years ago
All the atoms of an element are the________.​
Marizza181 [45]

Answer:

The answer is Particles

7 0
4 years ago
Read 2 more answers
Other questions:
  • During which period of pregnancy may drug exposure cause meromelia, cleft lip, and enamel hypoplasia?
    9·1 answer
  • Chemical messengers that are produced in one location in the body, released into the blood, and travel to other locations, where
    15·1 answer
  • Which of the following weighing balances performs measurements in a closed compartment with no air currents to disturb measureme
    8·1 answer
  • what kind of interaction is a pod of dolphins hunting and feeding on a school of fish is an example of
    10·1 answer
  • What purpose does mRNA serve?
    12·1 answer
  • Considering the Mendelian traits tall (D) versus dwarf (d) and violet (W) versus white (w), consider the crosses below and deter
    10·2 answers
  • The process of respiration is essential in the oxygen/carbono dioxide carbon cycle. Respiration remoces From the atmosphere and
    7·1 answer
  • What is meant by extinction
    12·2 answers
  • The carbon fixation reaction converts?​
    12·1 answer
  • Which of the following is the primary employer of natural resource professionals aPrivate landowners b Local governments c Unite
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!