1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sholpan [36]
3 years ago
8

Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG

Biology
1 answer:
trapecia [35]3 years ago
7 0

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

You might be interested in
Define organelle and describe why organelles are important to the cell.
Gnesinka [82]
An organelle is a cellular structure which performs specific functions within a cell. Organelles are important to the cell as cells would not be able to function without them: even the most common organelle - the nucleus. A cell without a nucleus cannot function (except prokaryotes, as they have an undefined nucleus)
4 0
4 years ago
evaluate whether having sickle cell disease would advantageous or disadvantageous to a person living in central africa
SVEN [57.7K]
<span>Sicle cell disease is disadvantageous in any continent. However in Central Africa ,where there is a lack of care for health and modernizaition, it will be too hard for a person to heal someone with sickle cell disease. The country is struggling with their sanity having a sickle cell disease will be difficult for them to find a donor who is healthy enough to donate blood.</span>
7 0
3 years ago
Carbon's valence is _____.<br> a. covalent<br> b. ionic<br> c. +4<br> d. -4
Tresset [83]
The answer is B hope this helps. 
5 0
4 years ago
In science we define force as
Law Incorporation [45]

force has many different definition, here are some examples.


1) Force is a push or pull

2) Force is the capacity to do work or cause physical change

3) Force= Mass times acceleration (F = ma)

<span>4) A force is that which changes or tends to change the state of rest or motion of a body</span>

5 0
3 years ago
Read 2 more answers
Which of the following are examples of genotypes?
Ksju [112]

Answer:

dominant ans self colored

Explanation:

please mark me as a brainlist

4 0
3 years ago
Read 2 more answers
Other questions:
  • How are work,force,and distance related?
    11·1 answer
  • Your science teacher brings in a speaker to talk to your class about climate change. During the session, students ask a few ques
    14·2 answers
  • A DNA strand has the sequence GTTCCAGAG. Which is the complementary strand of RNA?
    12·2 answers
  • What is the impact on human health as we try to stay ahead of the evolutionary process?
    10·2 answers
  • What are the 2 elements involved in the sun's production of energy?
    15·1 answer
  • Which forecasting method uses the data from the same date in the previous years
    7·1 answer
  • Which of the following is true regarding tissue?
    9·1 answer
  • Weather and Climate both occur in the what
    13·1 answer
  • How is Anaphase I in meiosis different than in mitosis
    8·2 answers
  • Can someone help pls
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!