1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sholpan [36]
3 years ago
8

Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG

Biology
1 answer:
trapecia [35]3 years ago
7 0

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

You might be interested in
Which characteristic of a pine tree is an adaptation to the climate of the northwestern coniferous forests? . A. Deep roots B. C
Pie
The correct answer is letter "B. Conical shape ." The characteristic of a pine tree is an adaptation to the climate of the northwestern coniferous forests is that it is in conical shape. If C were needle like leaves that would be the best answer.
7 0
3 years ago
Streamlining a car or boat can increase speed by decreasing friction. True or False
Fofino [41]
The answer to this is true

7 0
3 years ago
Read 2 more answers
What are restriction enzymes? what are restriction enzymes? exonucleases that degrade single-stranded dna endonucleases that ran
tangare [24]
Restriction enzymes<span>, also known as </span>restriction endonucleases<span>, are </span>enzymes<span> that cut a DNA molecule at a particular place. They are essential tools for recombinant DNA technology. The </span>enzyme<span> "scans" a DNA molecule, looking for a particular sequence, usually of four to six nucleotides.</span>
6 0
3 years ago
The main difference between starch and cellulose is that:
Musya8 [376]

Answer: the residues are connected differently in starch and cellulose.

Explanation:

Starch is formed from alpha glucose, while cellulose is made of beta glucose. The difference in the linkages lends to differences in 3-D structure and function. Starch can be straight or branched and is used as energy storage for plants because it can form compact structures and is easily broken down.

5 0
3 years ago
Read 2 more answers
PLZ HELP <br>(explain how plz)<br>thx!!<br>(also, there was no science subject so I put biology)
uranmaximum [27]
It has enhanced our knowledge in the science world greatly. Many cell organelles and chemical processes can be studied in more detail using the electron microscope.
3 0
3 years ago
Other questions:
  • Why do blood vessels and lymph vessels have valves?
    15·1 answer
  • Place the
    12·1 answer
  • Describe the conditions needed in order for any enzyme to function properly.
    14·1 answer
  • What best explains the trend shown?
    11·2 answers
  • one parent is homozygous cleft chin and the other is heterozygous. MAKE A PUNNET SQUARE to show the propability in their offspri
    10·1 answer
  • 1.
    6·1 answer
  • If an enzyme is added to a solution where its substrate and products are in equilibrium, what would occur
    15·1 answer
  • Which process involves making glucose without energy from sunlight?
    11·2 answers
  • Which of these is NOT considered to be an organic substance?
    11·2 answers
  • What do the circled arrows in the image indicate?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!