1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sholpan [36]
3 years ago
8

Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG

Biology
1 answer:
trapecia [35]3 years ago
7 0

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

You might be interested in
what are 3 reasons why it might be important to preserve botana curus ( story: The biodiversity crisis)
inessss [21]
3 reasons why it might be important to preserve botana Cyrus is because it has medical purposes (produces Curol), holds ecological value, and holds agricultural value.
6 0
4 years ago
Ollowing a disturbance, the climate of an area will always lead to repopulation by the same animal, plant, fungus, and bacterial
Bond [772]

The correct answer is Climax Community.

What is climax community?

A community of plants, animals, and fungi that have attained steady state through the process of ecological succession in the growth of the vegetation in an area over time is referred to in scientific ecology as a climax community or climatic climax community.

Because the climax community is made up of species that are best adapted to the region's typical conditions, it was believed that this equilibrium would emerge.

The climax community's species composition doesn't change since all of the existing species are able to reproduce, whereas invasive species are unable to establish a presence. The climax stage is not entirely permanent since ecological processes, evolutionary processes, and climate changes all alter the environment over extremely long stretches of time.

To learn more about climax community visit the link:

brainly.com/question/842832?referrer=searchResults

#SPJ4

5 0
2 years ago
Bacterial dna is used frequently in genetic engineering because
Damm [24]

It is found in the cytoplasm as a simple circle.

3 0
3 years ago
What is embryology?<br> Your own word
Dahasolnce [82]

Answer: The branch of biology and medicine concerned with the study of embryos and their development.

Explanation:

Reword that and mark me brainliest

8 0
3 years ago
A scientist repeats another scientist's experiment but guts different results. What are possible causes
Pachacha [2.7K]
If the results of an experiment have different conclusions, something must have changed. these are called **variables**. if more than one variable is changed, the result would be different. because the total conclusion is different, it is a hypothesis, because it is not universally true.
4 0
3 years ago
Other questions:
  • Why is is a good idea to wait at least an hour between eating and exercising?
    13·2 answers
  • If a cell is placed in a hypotonic solution, which will occur?
    6·1 answer
  • Food that accidentally enters the respiratory pathways is normally<br> removed by
    14·1 answer
  • It's best to drink beverages without calories. The calories from food leave us more satisfied than fluids and it's much easier t
    13·1 answer
  • Which of the following organisms exhibits radial symmetry?. Answer. Butterfly. Flatworm. Starfish. Tadpole.
    12·2 answers
  • How do toothed whales produce general communication sounds?
    9·1 answer
  • What is “selected” for in natural selection?
    7·1 answer
  • What is involved in the process of artificial selection?
    11·2 answers
  • Y’all know the answers to this
    13·2 answers
  • 21.1.2 Quiz: What Is Science?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!