1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sholpan [36]
3 years ago
8

Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG

Biology
1 answer:
trapecia [35]3 years ago
7 0

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

You might be interested in
If one strand of DNA had a base sequence of A-T-T-G-C-A, what base order would be found on the complementary strand of DNA?
ohaa [14]
The explanation is in the image. :)

5 0
3 years ago
How does human activity impact Earth's systems such as deforestation
KatRina [158]

Answer: Land, Water,Urbanization, and smog and acid rain.

Explanation:

Smog and acid rain are produced through similar sources, primarily vehicle and industry emissions. Though both result from human-caused air pollutants, there are chemical distinctions between the two. Though there are regulations in effect to reduce both types of pollution, they remain a threat to both human health and the environment.Smog Causes A combination of three components -- nitrogen oxides, volatile organic compounds (VOCs) and sunlight -- causes smog. Nitrogen dioxide interacts with sunlight to create nitrogen oxide and a free oxygen molecule. This interaction produces ozone, which typically turns back into nitrogen dioxide, and the cycle repeats. The addition of VOCs interrupts the cycle, however. VOCs are produced by various sources, such as paint, cleaning products and refrigerants. The VOCs prevent the breakdown of ozone, allowing it to gather near the surface of the Earth, where even more nitric oxides are produced by vehicle and industry emissions, creating the dense smog seen in large cities such as Los Angeles and Beijing.Smog Hazards The presence of ozone in the form of smog can have several negative health effects. Respiratory systems can be irritated, reducing overall lung function and triggering asthma attacks. Evidence reported by the Environmental Protection Agency also suggests exposure to ozone reduces immune system responses, especially in the lungs. These effects subside over time, but little is known about the long-term effects of repeated exposure. Vegetation also suffers from smog, as plants that take up too much ozone can be damaged in ways such as discoloration and a loss of leaves that cuts photosynthesis efficiency by up to 50 percent.

6 0
3 years ago
How to put asexual reproduction in a sentence
sveticcg [70]
Many plants have an asexual reproduction system and can reproduce by themselves without other plants sperm.

this was an example of how you can use it in a sentence.

i hope this helps you
5 0
3 years ago
Read 2 more answers
GENETICS AND FAST-TWITCH MUSCLES The gene ACTN3 encodes a protein that functions in fast-twitch muscles. People can be classifie
AVprozaik [17]

Answer:

From the given information above,

The P value is 0.592. P value is greater than the level of significance.

We do not reject the null hypothesis.

Explanation:

7 0
3 years ago
Which two layers are part of the thermosphere? *
Alina [70]

Answer:

"Ionosphere and Exosphere" is the right response.

Explanation:

  • The ionosphere seems to be the interface through which the Northern side lights originally come, or perhaps the Aurora Borealis. This same radioactivity including its sun throughout the ionosphere ionized particles the particulates emitting the logo lighting system of Aurora.
  • The exosphere, having started from five hundred kilometers, would be the outermost part of that same thermosphere. This same exosphere appears to contain slightly heavier gasses including such helium.
7 0
2 years ago
Other questions:
  • Why doesn't asexual reproduction result in variation among offspring and parents?
    9·2 answers
  • WILL GIVE A BRANILEST
    13·2 answers
  • According to the cladogram, which organisms are in the smallest clade with birds? mc011-1.jpg crocodiles primates rodents and ra
    7·2 answers
  • A. One factor that affects the amount of energy absorbed is the<br> in which a material moves
    15·1 answer
  • Mayras maternal grandfather into maternal uncle died of heart attacks and her mother has high blood pressure. What answer best e
    13·1 answer
  • Recent research has demonstrated a correlation between the presence of certain types of Gram-positive bacteria in the human gut
    10·1 answer
  • Where do producers get matter and energy to live and grow ?
    5·2 answers
  • What's the opposite of 0.5
    6·1 answer
  • True or false: A spider web is considered a biotic factor<br> A. True<br> B. False
    14·2 answers
  • Which is the fifth most common pool where carbon is stored apart from the Earth's crust, ocean, soils, and atmosphere?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!