1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sholpan [36]
3 years ago
8

Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG

Biology
1 answer:
trapecia [35]3 years ago
7 0

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

You might be interested in
HELP PLEASE
Pepsi [2]

Answer: B)

Explanation:

3 0
3 years ago
What can you conclude from the distribution of the red fluorescence.
natta225 [31]
The antibodies are very unspecific
7 0
3 years ago
Typical United States weather patterns show the continental polar air mass moving south toward the Gulf of Mexico. Why does this
Reptile [31]
The correct answer is letter (<span>C) The polar air mass moves south to replace the rising maritime tropical air mass.</span> These air masses are bringing cold air to warmer areas most especially during the winter and cool. These air masses are stable and usually does not form much cloud. While the Continental Polar air move down south, across the warmer land, the lower part of the air mass is modified and thus few clouds are formed.
3 0
3 years ago
Which statement describes a feature of equal are projection?
Delvig [45]
<h2><em>Answer:</em></h2>

<em>Option</em><em> </em><em>C</em>

<em>Latitude </em><em>lines </em><em>meet </em><em>at </em><em>the </em><em>poles.</em>

<em>Explanation</em><em>:</em>

<em>Several </em><em>equivalent</em><em> </em><em>projections </em><em>were </em><em>developed </em><em>in </em><em>an </em><em>attempt </em><em>to </em><em>minimize </em><em>the </em><em>distortion </em><em>of </em><em>countries </em><em>and </em><em>continents</em><em> </em><em>of </em><em>planet </em><em>Earth,</em><em>keeping </em><em>the </em><em>area </em><em>constant.</em>

<em>hope </em><em>it</em><em> </em><em>helps</em>

4 0
3 years ago
In diabetic patients, what molecule is missing in the transport system
Oksanka [162]
The answer to this question would be: insulin

Insulin is a hormone that produced by the pancreas. Insulin makes sugar go inside cells. Sugar is the food for cells. Without insulin, the sugar can't enter the cell and the cell food is depleted. This will cause the body feel that the sugar is not enough and trying to increase the sugar concentration. This will result in the increases of blood sugar level.
7 0
4 years ago
Other questions:
  • Atoms have three subatomic particles: protons, neutrons, and electrons. ... Knowing what you know about the nucleus and the suba
    8·2 answers
  • Many body systems work together for proper functioning of the body and to maintain internal homeostasis.
    12·1 answer
  • Continents grow by a process called ____
    15·1 answer
  • WILL GIVE BRAINLIEST!!!
    15·2 answers
  • How much mass is in a liter
    5·2 answers
  • If the caterpillar increases, what will happen to the leaf population? *
    8·2 answers
  • ASI
    10·1 answer
  • What are some closely related animals to the Marine Iguana?
    14·1 answer
  • Which was used o copy DNA for DNA figerprinting
    7·2 answers
  • If anyone don't know where is leaderboard check the attachment​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!