1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sholpan [36]
2 years ago
8

Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG

Biology
1 answer:
trapecia [35]2 years ago
7 0

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

You might be interested in
A group of students is reviewing information about cast composition in preparation for a discussion on the advantages and disadv
san4es73 [151]

Answer:

Plaster cast is made up from dry muslin containing starch or dextrose and calcium sulfate.

Explanation:

It is applied to protect and  is immobilize an injured bone or joint because it provides rigidity.

It is also used to help the bone and joint from reduce pain that is created during movement.

When plaster becomes wet,it reacts (Between water and calcium sulfate) and produces heat that eventually sets the plaster.It becomes hard when it dries.

The color of plaster casts are smooth and white.

4 0
3 years ago
Based on changes in human populations from ancient times to the present, what do you think might have happened to movement of hu
Nezavi [6.7K]

Answer:

All of them are right

Explanation:

7 0
2 years ago
A child is born with two more codons than those found in the DNA of their parents. How could this genetic difference have happen
Helga [31]
The answer ==is insertion and error occurs during the process motosed
3 0
3 years ago
Which of the following is a testable hypothesis?
beks73 [17]

The answer is B.

If you put one plant in wet soil, and one plant in dry soil, you can prove or disprove your hypothesis as the plants grow.

8 0
3 years ago
Which gland is known as the "master gland" because it sends chemical messages to many other glands?
natima [27]

Answer:

Pituitary gland is known as the master gland

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following describes asexual reproduction?
    10·2 answers
  • A person's body temperature begins to increase when in the direct sun. they start to sweat to decrease their raised body tempera
    7·1 answer
  • HELP
    11·2 answers
  • When blockages in the bloodstream read the Brian it can cause blank?
    12·1 answer
  • Which organ system makes blood?
    15·1 answer
  • What happens to 2 NADPH in photosynthesis?
    15·1 answer
  • I need help please...
    14·1 answer
  • Which of the following is a correct difference between RNA and DNA?
    11·2 answers
  • Match each brachial spinal nerve with the correct label.
    9·1 answer
  • How was the first enzyme discovered?<br> Please mention the whole process of its discovery.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!