1) To calculate the population density you first need to know how many <span>squirrels form that population.
To calculate the number of</span><span> squirrels:
1500</span> squirrels is the capacity, so it's equivalent to 100%
So how much squirrels are present in 80% of the area:
1500----100 %
x----------80 %
x= 1200 <span>squirrels
</span>
2)Population Density equals the number of squirrels divided by the land area
In the first part was calculated the number of squirrels and the exercise gives us the area in hectares so the only thing left to do is divide them.
(since this exercise doesn't specify that the area needs to be in a certain measurement we can use hectares)
Population Density = 1200/ 150
<span>The population density of the squirrels is 8 per hectare</span>
Its An experiment because it doesnt ask a testable question
So its B
i hoped it helped SIS
<span>C. Pickles are stored in salt water to prevent them from spoiling.</span><span>
A hypothesis is a supposition made by the scientist. In order for a hypothesis to be a scientific hypothesis, the scientific method requires for it to be tested. If a hypothesis cannot be tested, it cannot be scientific hypothesis. It is important to state the hypothesis clearly at the beginning of a scientific paper. This enables the reader to understand the problem. </span>
Answer:
Explanation:
a. The template strand is:
ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT
The coding strand is
TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA
The sequence encoding the five amino acids is: 3' CTA-ATC-AGA-CCG-TAC-CAT 5'
b. 5' AUG-GUA-CGG-UCU-GAU-UAG 3'
c. N terminus Met-Val-Arg-Ser-Asp C terminus
d. GGAGGA
e. The shine Delgarno sequence as a mRNA binding site for mRNA's binding to the small subunit ribosome.
Answer: Grassland, deciduous forest, and desert.