Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
X-rays are the radiation that allows us to see through the skin to visualize bones
Answer: Homologous chromosomes are the pairs of chromosomes that having same gene sequence, equal length of arms and centromere location. Homologous chromosomes have two homolog one come from male parent and other come from female parent.
Explanation:
These chromosomes Are formed for the purpose of genetic variations. They are called homologous because when two same structured exist it form pair together
Answer:The Doppler radar used in weather forecasting measures the direction and speed, or velocity, of objects such as drops of precipitation. This is called the Doppler Effect and is used to determine whether movement in the atmosphere is horizontally toward or away from the radar, which aides in weather forecasting.
Explanation: