1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xxMikexx [17]
3 years ago
10

Complex chemical catalysts produced by living cells are enzymes.

Biology
1 answer:
Bas_tet [7]3 years ago
4 0
Yaa that statement is true, complex chemical catalyst of living cells are enzymes
You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
What do we call the radiation that allows us to see through the skin to visualize the bones?
Brrunno [24]
X-rays are the radiation that allows us to see through the skin to visualize bones
4 0
3 years ago
Which is a homologous chromosome pair?
nadezda [96]

Answer: Homologous chromosomes are the pairs of chromosomes that having same gene sequence, equal length of arms and centromere location. Homologous chromosomes have two homolog one come from male parent and other come from female parent.

Explanation:

These chromosomes Are formed for the purpose of genetic variations. They are called homologous because when two same structured exist it form pair together

8 0
3 years ago
How is radar used to forecast weather
juin [17]

Answer:The Doppler radar used in weather forecasting measures the direction and speed, or velocity, of objects such as drops of precipitation. This is called the Doppler Effect and is used to determine whether movement in the atmosphere is horizontally toward or away from the radar, which aides in weather forecasting.

Explanation:

8 0
3 years ago
Read 2 more answers
What are fungi? Give three examples.
MAXImum [283]

Answer:

Yeasts

mold

mushrooms

Explanation:

brainliest?

3 0
3 years ago
Read 2 more answers
Other questions:
  • Assessment timer and count Assessment items Item 5 At each step, a dichotomous key involves how many choices?
    14·2 answers
  • Which abiotic factor is essential to all aquatic ecosystems except ocean hydrothermal vents and why?
    10·1 answer
  • Classify each description according to the X-linked recessive disorder it describes.
    9·1 answer
  • How do you expect the period of a planet to change as its average distance from the sun increases?
    13·1 answer
  • If A has a free energy of 38 units, and C has a free energy of 45 units, and the reaction is exergonic, based on the calculation
    11·1 answer
  • Which is an example of a vestigial structure a( tailbone of a human
    10·1 answer
  • Some roses have streaks of pink and streaks of red to give a striped effect to
    6·1 answer
  • However, by comparing the of these organisms, many similarities between them are revealed. These similarities suggest that they'
    8·1 answer
  • What are the best conditions for ginger root to grow?.
    12·1 answer
  • Pls help I will give brainliest
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!