1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
beks73 [17]
4 years ago
13

The growth of a plant toward light is an example of _____.

Biology
2 answers:
Svetradugi [14.3K]4 years ago
8 0
The most appropriate answer is Response !!

It is due to auxin present in tip of stem !!
sergejj [24]4 years ago
7 0

Answer is response

The growth of a plant toward light is an example of response. This response is called phototropism. The growth of plant parts towards light is phototropism. Growth towards light is positive phototropism, example growth of stem towards light. Growth away from light is negative phototropism, example, growth of roots.

You might be interested in
Biome Description Biome Name
iris [78.8K]
1. Temperate deciduous forests
2.?
3.savannas
4.temperate grassland
7 0
3 years ago
What are the stages of infection?
Stolb23 [73]

Answer:

1. incubation

2. prodromal

3. illness

4. decline

5. convalescence

8 0
3 years ago
Read 2 more answers
Greg says that he usually eats 1 medium carrot every day to ensure that he's consuming enough vitamin
Triss [41]
Vitamin a stays accumulated in your system and so only a concern if Greg is vitamin a deficient but he is probably getting other sources of vit a in his diet as well
5 0
3 years ago
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
nydimaria [60]

I don see the question if there is one can you explain and ill edit my answer to best fit

8 0
3 years ago
The end products of photosynthesis include
Arlecino [84]

Answer:

Food for the plant and the ground soil around the plant will get nutrients.

Explanation:

7 0
3 years ago
Other questions:
  • Is genetic engineering a good idea? I need details ok Here is Me Teacher feedback, Hi, Gabriel! I really enjoyed your work so fa
    15·1 answer
  • when a bobcat gets too hot it can swear through the skin on its paws how does this help the bobcat to regulaye its internal temp
    5·2 answers
  • Which is the largest gland in the body?
    9·2 answers
  • What two measurements does a GPS device use to find a specific location? How many satellites does a
    12·1 answer
  • Why are plant cells more resistant than animal cells to lysis in hypotonic solutions?
    14·1 answer
  • Did Lorenzo appear normal at birth
    5·2 answers
  • How are primary and secondary ecological succession similar?
    7·1 answer
  • When you see _____ clouds it means the weather might be changing soon.
    8·1 answer
  • All of the following are believed to be causes of extinction except____
    12·1 answer
  • How would i describe transcribe
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!