1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iris [78.8K]
3 years ago
5

A testable explanation that's supported or refuted is called a/an

Biology
2 answers:
stiks02 [169]3 years ago
7 0
<span>The answer is the option C. hypothesis. If the option A, confuses you, think that an experiment is not per se an explanation, it is just a way to run trials to determine something. Hypothesis are statements that establish a possible relations between facts but that are not proved. Then you can design an experiment to test the validity or not of the hypothesis. You should not make hypothesis that cannot be testable. </span>
Allushta [10]3 years ago
3 0

A hypothesis is a testable explanation that supports or refuted.

Further explanation:

The scientific method is a series of different steps that can be used to collect knowledge about different biological phenomena. This technique involves five different methods. It starts with making <u>observations, asking questions, formulating a hypothesis, carrying out an experiment, analyzing data, and creating a conclusion.</u> Scientific experiments are examples of the scientific method.

Observation is the initial step of the scientific method. It involves the collection of information related to the topic. The hypothesis is formulated by an <u>observation that tentatively attempts to explain some phenomenon</u>. It is an explanation for a natural process, particular observation or specific condition. It is the primary step to initiate the scientific experiment. It <u>gives the purpose to initiate the experiment</u> or to explore the area more thoroughly. A single study can provide more than one hypothesis.

Experiments are designed and <u>perform to test the hypothesis</u>. It obtains data that can either support or contradict the hypothesis. An analysis is the result of the experiment. It includes detail of all observation, sufficient information and data such as tables and graphs collected in an experiment. A <u>valid result is obtained by analyzing the data</u> of an experiment. It is based on the fact observed during the experiment. It helps in determining whether the conclusion of an experiment is a correct explanation of the phenomenon. Based on the experiment, the result theory is created. <u>The theory is the explanation of a summary drawn from an experiment</u> that supports the hypothesis and verified by many investigators. It is a result of the tested and confirmed hypothesis. The <u>conclusions are the final and original presentations</u> of information.

Learn More:

1. Learn more about meiosis <u>brainly.com/question/1600165 </u>

2. Learn more about the process of molecular diffusion in a cell <u>brainly.com/question/1600165 </u>

3. Learn more about human sperm and egg cell <u>brainly.com/question/1626319 </u>

<u> </u>

Answer Details:

Grade: High School

Subjects: Biology

Topic: Scientific Method

Keywords:

Scientific method, hypothesis, observation, experiment, analyzing, conclusion, theory, summary, presentation, information, tables, graph, biological phenomena.

You might be interested in
Which plant cell structure stores large amounts of chemicals—including salts, minerals, proteins, and water—for the cell and hel
Vedmedyk [2.9K]
Always been taught that the vacuole holds the cell's water. I don't know about the other things <span />
7 0
3 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
1. A certain disorder is recessive and sex-linked. Circle all of the geno-
madreJ [45]
X^r X^r and X^r Y.......
4 0
3 years ago
How are plants in a sunny meadow and sulfur bacteria in a deep sea vent alike?
yan [13]
Well it’s obvious that they both use Photosynthesis to make there own food, and also they both use chemosynthesis the produce there own food. Very simple. :)
6 0
3 years ago
Read 2 more answers
Mrs. Jones who has dementia. She continues to ask for her husband, whom you know passed away several years ago. How would you as
wlad13 [49]

Answer:

You tell her that her husband is away and will be coming back later

Explanation:

If you tell her he's dead, she won't believe you so just go along with it.

3 0
2 years ago
Other questions:
  • Explain character displacement, and provide an example.
    9·1 answer
  • A man presents to an ER with a large laceration sustained at a construction site a few hours before. The area around the lacerat
    15·1 answer
  • Which scientist formed his ideas about living things by performing observations with out using a microscope? A.Hooke B.malpighi
    15·2 answers
  • What is the structural feature that accounts for conductivity in electrolytes?
    10·2 answers
  • Morphine combined with alcohol can produce _____ effects
    7·2 answers
  • Which type of zone is located at a deep-ocean trench?
    14·2 answers
  • A client is to undergo surgery to repair a ruptured Achilles tendon and application of a brace. The client demonstrates understa
    6·1 answer
  • What definition goes with what cell?
    15·1 answer
  • Which one of the four carbon based molecules are enzymes?
    12·1 answer
  • Tiger sharks are unlike other sharks in what way (2 answers)?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!