1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zaharov [31]
3 years ago
5

In which type of muscular contraction does the muscle change length either shortening or lengthening?

Biology
1 answer:
Brilliant_brown [7]3 years ago
6 0
The Answer is isotonic
You might be interested in
Right now, we are threatened by global climate change. This is due to changes in _____ conditions, an increase in _____.
Ludmilka [50]
<span>onosphere rise in sea level</span>
3 0
3 years ago
Read 2 more answers
.Which statement best illustrates why carbon is so important to living things?
Elina [12.6K]
<span>Carbon-based macromolecules are found in all life forms.</span>
6 0
2 years ago
Read 2 more answers
50 POINTS PLUS BRAINLEIST FOR BEST ANSWER! I NEED HELP FAST ITS DUE TOMORROW!
Svetach [21]

Answer:

Explanation:

Helium is the second most abundant element in the universe, but here on earth, it's rather rare. Most people guess that we extract helium from the air, but actually we dig it out of the ground. Helium can be found in certain parts of the world, notably in Texas, as a minor component in some sources of natural gas.

Helium is generated underground by the radioactive decay of heavy elements such as uranium and thorium. Part of the radiation from these elements consists of alpha particles, which form the nuclei of helium atoms. ... Helium can also be produced by liquefying air and separating the component gases

When the gas contains more than about 0.4% helium by volume, a cryogenic distillation method is often used in order to recover the helium content. Once the helium has been separated from the natural gas, it undergoes further refining to bring it to 99.99+% purity for commercial use.

4 0
2 years ago
Read 2 more answers
Earthworms, which are land invertebrates, and caecilians, which are amphibians, have evolved with traits that enable them to bur
Agata [3.3K]
Natural selection? Mutation? 
8 0
3 years ago
Bone deformities occur due to the excess intake of
ololo11 [35]

Answer:

D) Fluorine

Hope this helps :)

6 0
2 years ago
Other questions:
  • Why does the presence of 22 large herbivore species at Mpala seem to contradict the competitive exclusion principle Dr. Pringle
    12·1 answer
  • Which of the following is a possible litter for two heterozygous black mice?
    5·1 answer
  • Which statement about energy is true? A. Energy can’t be created or destroyed. B. Energy can’t transform into different forms. C
    11·1 answer
  • Why is the pancreas considered part of the immune system
    15·2 answers
  • In an asexually reproducing organism it is expected that the offspring will be genetically identical to the parent. However, in
    11·1 answer
  • R it answe know it dont If you dont
    9·1 answer
  • Which of the statements regarding the nitrogen cycle is true? a. Denitrification occurs when a nitrogen containing compound is p
    8·1 answer
  • Will mark BRAINLIEST to correct answer
    15·2 answers
  • Physical or behavioral traits that are best suited for an environment are
    7·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!