1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
poizon [28]
3 years ago
5

3). Which process can result in increased biomass for a plant: cellular respiration or photosynthesis? Where does the mass come

from? What molecules are taken in by the plant cells?
Biology
1 answer:
Karo-lina-s [1.5K]3 years ago
5 0
Photosynthesis results in increased biomass for a plant. I<span>n photosynthesis, carbon dioxide and water yield glucose and oxygen. So, the carbon dioxide and water are taken in and are create a glucose. Glucose can be transformed into organic molecules, such as starch, which will increase biomass.</span>
You might be interested in
What type of boundary is at letter C?<br><br> O Divergent<br> O Convergent<br> O Transform
tangare [24]
B


A convergent boundary is an earth where two or more lithospheric plates collide
7 0
3 years ago
Somebody please help me​
kondor19780726 [428]
It’s process of gametes
7 0
3 years ago
Think about the water and how it rolls up the beach. Think of all it qualities. Is it alive according to the characteristics of
Debora [2.8K]
It's not alive, nor is it even an organic compound.

- It cannot respond to stimuli (Responsiveness)
- It cannot secrete hormones (Secretion) 
- It cannot send messages along a nervous system or anything similar (Conductivity) 
- It cannot break down compounds to usable energy forms (Digestion) 
- It cannot absorb broken down compounds as an energy source (Absorption) 
- It cannot reproduce (Reproduction) 
- It cannot grow--it has no cells (Growth) 
- It cannot exchange gases between cells (Respiration) 
- It cannot rid itself of waste material (Excretion)
8 0
3 years ago
I would really appreciate some help with this science question!
jasenka [17]

so you’d need to find the amount of gallons your family uses in 11 minutes and subtract 73000 from that number

i used the same formula, came up with 80300 gallons a year, and subtracted 73000 from it to get

7300 gallons are saved by reducing showering time by one minute

6 0
3 years ago
1. All fungi are ____
balandron [24]

Answer:

All fungi are heterotrophic. (B)

6 0
3 years ago
Other questions:
  • These jars show the set-up from Francesco Redi's experiment with meat and maggots. After a few days of sitting out, the covered
    5·2 answers
  • The difference between the cellular makeup of a living organism in an aluminum can is the ____.
    11·1 answer
  • B) How many species has the genus Homo had in the course of history and when did this
    6·1 answer
  • The deepest point in the ocean is called the Challenger Deep and is located in the Mariana Trench. Which of the following can be
    7·2 answers
  • I don’t understand this. Please help.
    6·1 answer
  • Plz it will help me alot​
    14·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Name some examples of electromagnetic waves. Compare the wavelength and frequency of your examples
    5·1 answer
  • Section 10.3<br> How does a cell control the process of cell division?
    6·1 answer
  • When assigning a scientific name to an organism,
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!