1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ganezh [65]
3 years ago
6

Explain how an inmune system response starts after a macrophage attacks a pathogen?

Biology
1 answer:
Softa [21]3 years ago
5 0
<span>An immune response starts after a macrophage attacks a pathogen by engulfing and digesting them.</span>
You might be interested in
In 1988, wildfires in Yellowstone National Park scorched 1.4 million acres, approximately 36% of the park. Although many trees,
dolphi86 [110]
The charcoal produced by the burning of the woods provides nutrients for reforestation.
3 0
3 years ago
Chemical found in the nucleus that controls the production of protein
Ludmilka [50]

Answer:

Histones

Explanation:

4 0
3 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Which of the following statements about autosomal recessive traits is true?
meriva

Answer:

A. If neither parent expresses the trait, but the offspring does, both parents must be heterozygous for the trait.

Explanation:

If neither parents express the trait is because they are heterozygous and the dominant allele is being expressed over the recessive trait. When parents cross they have 25% of having an offspring that expresses the recessive trait, this means the offspring is a recessive homozygous. In the attached example 25% or 1/4 will have a short stem.

6 0
4 years ago
Please help giving brainliest whats the answer??????
Marrrta [24]
Global winds I’m pretty sure
3 0
3 years ago
Other questions:
  • About what percentage of eukaryotic DNA transcribes protein?
    12·1 answer
  • Which is the first step that occurred in the speciation of the galapagos finches
    5·2 answers
  • Inside a prokaryote, such as E. coli, an operon controls for the production of the amino acid tryptophan. What occurs in the cel
    12·2 answers
  • Which of the following statements regarding the digestive system is correct?
    14·1 answer
  • What major explanation did Charles Darwin provide? A. He explained how DNA is passed on but did not have evidence of it occurrin
    7·2 answers
  • _______________________are tiny openings in the leaves of a plant through which the plant takes in and releases gases.
    5·1 answer
  • Which statements describe characteristics of deposition? Check all that apply.
    8·2 answers
  • The fungi Basidiomycota are often used for making _____.
    9·2 answers
  • Bacteria in your lab are grown under two conditions, one with exposure to glucose and the other with lactose. what best describe
    11·1 answer
  • Which of the following is a biotic factor in an ecosystem?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!