1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sunny_sXe [5.5K]
3 years ago
11

Which of the following is not a component of a virus

Biology
2 answers:
xeze [42]3 years ago
6 0
Tail section .......
Juliette [100K]3 years ago
4 0
Tail section is the answer
You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Describe some of the problems faced by benthic organisms in the ocean
alina1380 [7]

The benthic organism is an organism that lives on, in or near the seafloor. This also helps the environment and marine life by providing structure, alter water currents, and stabilize shorelines, hard substrate settlement. Some recycle nutrients and improve water quality. An animal of a large group distinguished by the possession of a backbone or spinal column, including mammals, birds, reptiles, amphibians, and fishes. 

5 0
3 years ago
Read 2 more answers
When a therapist uses techniques from various types of therapy, the person is said to be using
kogti [31]

Answer:

An eclectic approach

Explanation:

An eclectic approach is an approach that combines multiple different approaches. In psychotherapy, an eclectic approach can be described as one that relies on multiple theoretical orientations and techniques. This allows the therapist to be flexible and use methods that best suit their client's individual needs.

5 0
2 years ago
Which organelle of the plant cell could easily be represented by a large inflated ballon
Fudgin [204]

The vacuole is the answer

4 0
3 years ago
Motor and associative neurons are able to receive information from many different sources simultaneously because of their profus
miskamm [114]

Motor and associative neurons can receive information from many different sources simultaneously because of their profusion of highly branched dendrites.

<h3>What are Dendrites?</h3>
  • Dendrons, which are also known as dendrites, are branched protoplasmic extensions of a nerve cell that transmit the electrochemical stimulation that the cell body, or soma, of the neuron from which the dendrites project, receives from other neural cells.
  • Through synapses, which are distributed throughout the dendritic tree, upstream neurons (often via their axons) transmit electrical stimulation onto dendrites.
  • Dendrites are essential for integrating these synaptic inputs and controlling how much an action potential is generated by a neuron.
  • A multi-step biological process called dendritic arborization often referred to as dendritic branching, is how neurons grow new dendritic trees and branches to produce new synapses.

To learn more about Dendrites, refer to:

brainly.com/question/19435017

#SPJ4

7 0
1 year ago
Other questions:
  • Need helpppppppppppppppppppppppppppppppppppppppppp
    9·2 answers
  • Reptiles do not live in the Arctic; however, some birds do live in the Arctic even though they evolved from reptiles. Offer an e
    8·1 answer
  • At which steps do cells control gene expression?
    7·1 answer
  • In peas, yellow seed color (V) is dominant to green seed color (y). Which describes an organism that has nonidentical
    10·1 answer
  • What is the process of VEGETATIVE PROPOGATION?? PLEASE HELP ME and Thank you so much!!
    12·1 answer
  • 1. What is the relationship among chromosomes, genes, and DNA?
    5·2 answers
  • A carrier of a genetic disorder who does NOT show symptoms but who CAN pass on a disease to his or her offspring would have whic
    5·1 answer
  • SC.8.L.18.4A student picked up Ball A off a shelf and threw it. In this action light energy from the sun is transformed into che
    11·2 answers
  • describe the effect of magnesium deficiency on the transport of sucrose out of the leaves and the sucrose concentration out of t
    5·1 answer
  • If a virus can't attach to a cell it can't inject its genetic material.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!