1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex777 [14]
3 years ago
7

I did an experiment on the enzyme catalase. The aim was to determine effect of temperature on enzyme catalase. I was told a hypo

thesis was a true statement about the experiment. What is can be the hypothesis of this experiment?
Biology
1 answer:
aniked [119]3 years ago
8 0
Hi
Firstly, you have to try to argument something logical, so, take on count <span>there should be a correlation between the two: for instance, as the temperature increases, the rate of enzyme activity increases and take into consideration the fact that high temperatures denature enzymes hence they will no longer be effective in catalyzing reactions. In this way, you could do a great job.</span>
You might be interested in
Which process is represented by the arrow in the diagram below?
Marina86 [1]

Answer:

I think it might be respiration

Explanation:

8 0
3 years ago
All of the following cause mechanical weathering EXCEPT ____.
Elan Coil [88]
The answer is D.<span>carbonic acid </span>because that would be chemical weathering  
6 0
3 years ago
The chorion develops into the ____________, a pancake-like structure that is attached to the endometrium and is about 7 inches i
dezoksy [38]
The chorion develops into the PLACENTA, a pancake-like structure that is attached to the endometrium and is about 7 inches in diameter and 1-2 inches thick.

Placenta is an organ present inside the uterus that contains the fetus and connects the fetus to the uterine wall of the mother. The fetus derives all the nutrients and food from the mother with the help of placenta.
7 0
3 years ago
Which process is best illustrated by the diagram?
lakkis [162]

Answer:

Photosynthesis

Explanation:

bc thats how plants like it uwu

5 0
3 years ago
Read 2 more answers
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Other questions:
  • What are two examples of heat or pressure that can form metamorphic rock
    14·2 answers
  • Rough-skinned newts and common garter snakes are in an "evolutionary arms race." In this phenomenon, two species continually evo
    6·2 answers
  • Please help me 40 points!!! im being timed and i only have 15 minutes!!!
    11·1 answer
  • When a disaccharide is formed, how many water molecules are formed.
    10·1 answer
  • Name the two types of variables in an experiment<br> plz answer
    12·1 answer
  • What is the relationship between mutation and mutagen ?
    9·2 answers
  • What do you think life is like on other planets ? 3-5 sentences
    13·1 answer
  • (a)<br>Name the gas given off in photosynthesis​
    14·2 answers
  • .....................
    6·1 answer
  • Please help me! I'll give tons of points.​
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!