1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mr_godi [17]
3 years ago
7

Olfactory sensory neurons are short-lived and, therefore, replaced frequently. how does this turnover happen?

Biology
1 answer:
Anton [14]3 years ago
4 0

Mitotic division and differentiation of basal epithelial cells.

You might be interested in
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
VladimirAG [237]

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

5 0
2 years ago
Also this one, which type of crystal is this?
valentina_108 [34]

Answer: Looks similar to a smoky quartz.

3 0
3 years ago
Around the edges of many dry areas, sensitive ecosystems depend on local plant life to maintain cool, moist conditions. When hum
lisabon 2012 [21]
Pollination cycles do not really have any direct effect with the soil. Releasing moisture from leaves does replenish some water needed in the soil that is cycled back through the transport systems of plants but does not hold back soil. Photosynthetic activities only draw up nutrients, minerals, and water from the soil through roots.

Therefore, the often elaborate ROOT SYSTEMS are the answer. This is because the roots hold the plants in the ground (soil) and by this, the plants prevent natural disasters, artificial actions, and/or excess water to wash away soil. The roots help to reinforce the soil and hold it together.



6 0
3 years ago
How does tobacco smoke affect your body​
kykrilka [37]

Answer:

Tobacco effects the body in ways such as, unhealthy teeth, heart problems, premature aging of the skin, blood clots, and in some cases yellowing of fingertips.

Explanation:

4 0
3 years ago
Read 2 more answers
Which temperature generated the greatest oxygen production?
Dovator [93]

Answer:

Option A, 30 C

Explanation:

Plants are able to produce oxygen through the process of photosynthesis and photosynthesis is well carried in the presence of light at a warm temperature of 28 degree Celsius. The rate of photosynthesis falls if the temperature rises above 28 degree Celsius and with falling rate of  photosynthesis, rate of oxygen production also falls.

The rate of photosynthesis and hence the oxygen produces also falls when the temperature falls below 28 degree celsius.

Since, the nearest temperature range is 30 degree celsius thus  option A is correct

4 0
3 years ago
Other questions:
  • Which genetically engineered medicine is used to treat patients who have growth defects? insulin flu shot human growth hormone p
    6·2 answers
  • More than one million years ago, a single species of finch migrated to the Galapagos from the mainland of Central or South Ameri
    5·1 answer
  • To maintain turgor pressure, cells in both the leaves and stems of most non-woody or herbaceous plants contain A) chloroplasts.
    5·2 answers
  • Which organism’s DNA will be most similar to the leopard?
    8·1 answer
  • Which process is this?
    15·2 answers
  • Which of the following best describe(s) the function of the 5' mRNA cap?
    7·1 answer
  • Unlike life at the top of a body of water, life at the bottom of the body of water A. performs much more photosynthesis. B. rece
    9·2 answers
  • Can you do this for me - correct answer gets brainliest!
    12·1 answer
  • a mother has heterozygous type a blood and the father has type ab blood. what is the probability of the offspring having type O
    13·1 answer
  • Tay-Sachs Disease is a rare recessive disorder. A male that is a carrier for Tays-Sachs marries a woman that does not have a his
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!