The answer is sexual reproduction in which the creation of offspring by fertilization consisting 2 haploid gametes come together to form a diploid zygote with a new genetic combination. The main difference between sexual and asexual reproduction is that asexual reproduction results in a genetically identical offspring whereas sexual reproduction results in a unique offspring in which offspring with a new genetic combination.
Ethics are principles that govern a person’s behavior or the conducting of an activity
<h2>(A) is the correct option </h2>
Explanation:
- An organism is part of a community is correct,where species interaction occurs between different organisms
- A community is part of population is the incorrect statement because a community includes group of population of two or more different species
- An ecosystem is made up of only organisms is the incorrect statement because ecosystem is the community of both living and non living components of the environment and how they interact with each other
- A biome is the biotic part of an ecosystem is incorrect because biome includes the community of both plants and animals occupying a large habitat
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
this is for the first image with the marshmallows in campfire-There are two main processes that heat a marshmallow: absorption of campfire radiation photons and contact with very hot air rising off the fire convection. If we place the marshmallow directly above the fire, we get both.