If you're answers consist of:
<span>
a. mutation
b. genetic drift
c. inheritance of acquired characteristics
d. natural selection
Then you're answer is D.) Natural Selection
Hope this helped!! :)</span>
Organic molecules, which are found mostly in food. These molecules have C-C or C-H bonds, which are high energy bonds.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
ANSWER
Mixture
Explanation: the air is composed of nitrogen and oxygen
Answer:
Tips for helping patrons to manage material.
