Answer:
A grasshopper is not a producer.
Explanation:
A grasshopper eats plants; therefore it is a consumer, also known as a heterotroph.
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Answer:
Yes
Explanation:
Muscular strength in general (including respiratory muscles) is developed by systematic training, so it is assumed that it has a positive effect on the lung function. Recent studies have shown that athletes have larger capacity of the respiratory system when compared to their age-matched sedentary controls.
Answer:
Yes
Explanation:
I think the attraction in the solid is stronger than the ones in the liquid because it takes several particles to come together so it creates a solid. Therefore it creates a stronger attraction than the liquid since the liquid dosnt have as much mass as the solid. (not quite sure though)
<span>d. production of chemicals to ward off insects
</span><span>Adaptations are the result of evolution in different living organisms. This process occurs amazingly through gene mutation but it takes a very long period in time. Adaptation processes occur to help species survive and thrive in the ecological balance of life. Structural adaptations are physical features of an organism that adapted through time.</span>
