1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vika [28.1K]
3 years ago
9

Which of these is a process by which water, carbon dioxide, and energy are formed?

Biology
2 answers:
Naya [18.7K]3 years ago
8 0

Answer:

Respiration

Explanation:

Margarita [4]3 years ago
6 0

Answer:

aerobic respiration

Explanation:

Glucose and oxygen react together in cells to produce carbon dioxide and water and releases energy. The reaction is called aerobic respiration because oxygen from the air is needed for it to work.

You might be interested in
5) How are Parkinson's disease and ALS similar?
Dafna1 [17]
B. both diseases affect muscle control
3 0
3 years ago
Read 2 more answers
All of the following are problems caused by burning coal, except
yan [13]

Answer:

D)radioactive waste is produced

Explanation:

Radioactive waste is a dangerous waste material which contains radioactive substances that are bad for health. These waste are produced in the nuclear reactor for the production of electric energy. Radioactive substances cause many diseases in human such as burning of skin and cancer. It is a non-biodegradable substance which remains in the soil for long periods of time and emit alpha, beta and gamma radiations.

5 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Frie ex_greihusi unscheme
-BARSIC- [3]

Answer:

fire extingreihusi unscheme

4 0
3 years ago
Give two examples of how the endocrine system is important to the process of reproduction in humans?
Pepsi [2]
It wakes up the hormones in your body so you can reproduce in the first place, and it also helps to mature and prepare your body, and your cells, so it is able to reproduce. By waking up those hormones, your body is able to perform reproductive processes
7 0
3 years ago
Other questions:
  • Which of the following leaf adaptations is not matched with its reason for variation? A) needles - protection B) succulents - wa
    15·1 answer
  • Proteins are made from amino acids. An amino acid has three parts that are joined to a central carbon atom. Identify the three p
    15·2 answers
  • 52. Why are enzymes essential to organisms?
    15·1 answer
  • There are three steps in recycling. which is the first step?
    15·2 answers
  • What is the term that refers to the range of animal and plant species and the genetic variability among those species?
    9·1 answer
  • Name two substances in the body that will move based on the principles of diffusion
    9·1 answer
  • The effect of an antibiotic, antiseptic or disinfectant on bacteria growth is gauged by what measure? Group of answer choices
    13·1 answer
  • How many possible open reading frames (frames without stop codons) are there that extend through the following sequence? 5'... C
    7·1 answer
  • Material to diffuse is independent or dependent variable
    5·1 answer
  • PLEASE HELP I WILL GIVE BRAINLIEST(10 points)
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!