1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Airida [17]
3 years ago
9

if you were given two mixtures and told that one is a solution how might you determine which one is the solution?

Biology
1 answer:
mixas84 [53]3 years ago
6 0
A solution is a compound, or a mixture and will probably show a slight discoloration or blur.
You might be interested in
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
VladimirAG [237]

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

5 0
3 years ago
What are the functions of the stratum corneum layer of the skin? select all that apply.
dezoksy [38]

The  function of stratum corneum prevent unwanted materials from entering and  excessive loss of water from existing the body.

<h3>What happens when the stratum corneum is damage? </h3>

Damage of stratum corneum lead to multiply skin impairment including increase transepidermal water loss , redness,and susceptibility to infection or irritation by external factors.

The function of corneum stratum to form a barrier to protect underlying tissue from infection, dehydration chemicals and mechanical stress.

to learn more about Stratum Corneum click here

brainly.com/question/4083023

#SPJ4

7 0
2 years ago
Can I have help pls I do not understand this
Serggg [28]
Thermal conductivity is not the answer for this question because it does not work
8 0
2 years ago
Alyssa investigates properties of matter. The answer to which question would best
timofeeve [1]

Answer:

This question is incomplete as it lacks options, the options are:

A) What is the radius of each particle of the substance?

B) Does the substance contain more than one type of atom?

C) Was a chemical reaction necessary to create the substance?

D) What is the electrical charge of the particles of the substance?

The answer is B

Explanation:

In chemistry, an element is a substance made up of a single type of atom i.e. only one atom of the same type constitutes an element while a compound is a substance that contains two or more different elements. If a compound contains different elements, it means that a compound will certainly contain more than one type of atom.

According to this question, the best question to ask when Alyssa wants to differentiate between an element and a compound is: DOES THE SUBSTANCE CONTAIN MORE THAN ONE TYPE OF ATOM?

- If the answer is yes, the substance is a COMPOUND

- If the answer is no, the substance is an ELEMENT.

6 0
3 years ago
What are some structural explanation for why animal and plant cells differ in response to changes in the extracellular space?
Brums [2.3K]

Answer:

The animal cells produce the collagen but the plant cell does not produce collagen that responsible for producing the complex structure of protein and carbohydrates that is called extracellular matrix cell. Collagen is an important protein that provides strength to the structural integrity. On the other hand, the plant has not collagen so they have their extracellular supportive structure. The cell wall is so rigid and covered by the cell that protects it that provides shape and support to it. The plant cell also made up of molecules and these are called cellulose. These cellulose structured into the fibers that are called micro-fibrils

4 0
3 years ago
Other questions:
  • If the moon were to suddenly disappear, which of the following would be a likely result? (Select all that apply)
    8·1 answer
  • Different types of cells within an organism ______.
    8·1 answer
  • Why were Victorian hat makers prone to mercury posioning
    14·1 answer
  • Molecule that contains the information for the growth and functioning of the cell
    14·1 answer
  • The intensity of a sound is another way to say the _________ of a sound.
    15·2 answers
  • PLEASE ANSWER: Why are donkeys and horses considered different species?
    6·2 answers
  • Place the steps shown below in the correct order.
    7·1 answer
  • Where do the small molecules like water pass through the membrane?
    9·1 answer
  • 20 POINTS! <br> It's for a quiz so answer quick
    5·1 answer
  • Please help me i’ll give you brainlist
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!