1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Damm [24]
3 years ago
5

Need Answer ASAP only 4 min

Biology
2 answers:
enot [183]3 years ago
8 0

Answer:

H

Explanation:

This is the circulatory system, also called the cardiovascular system or the vascular system, is an organ system that permits blood to circulate and transport nutrients (such as amino acids and electrolytes), oxygen, carbon dioxide, hormones, and blood cells to and from the cells in the body to provide nourishment.

Lelechka [254]3 years ago
3 0
H is the answer!!! :)
You might be interested in
Complete the following analogy "skeletal is to support as immune is to??
amm1812
Protect. The immune system protects the body from diseases and harmful pathogens. The skeletal system keeps you upright and supports you with help from the muscles.
3 0
3 years ago
A microbiologist plated a bacterium on a specific medium. After incubation, she noted that the previously yellow medium was now
alexdok [17]

Answer:

A differential medium

Explanation:

Bacteria require nutrients for growth, and in order to culture (grow) them and study their characteristics, different types of media are used.

A selective media is used to grow a particular group of organism while suppressing another. So a selective media usually has an inhibitory agent, which will inhibit the growth of the undesired group. An antibiotic can be added to a medium to make it selective.

A general purpose medium as the name implies can be used to grow any group of bacteria. It has no inhibitory agent and indicator that differentiates between organisms. An example of general purpose media is nutrient agar .

A non-synthetic media is made from natural ingredients.

A differential media differentiates between groups of organisms. Example of differential media is MacConkey agar and Mannitol Salt agar. On MacConkey agar, lactose fermenting bacteria turn pink while non-lactose fermenting bacteria are colorless.

On Mannitol Salt agar, mannitol fermenting bacteria turn yellow while non-mannitol fermenting bacteria are colorless. Mannitol Salt agar is also a selective medium. It has a high salt concentration which inhibits certain organisms.

6 0
3 years ago
Radioactivity was discovered around what year?
RideAnS [48]
Radioactivity was discovered in 1896
6 0
3 years ago
Easy Question. Will Mark Brainliest.
dexar [7]

Answer:

This is an example of biotechnology because it seeks to solve a societal problem using biological entities.

8 0
3 years ago
Read 2 more answers
What is the chemical formula for the stable ionic compound formed between lithium and iodine?
serg [7]

Answer:

google

Explanation:

google helps good

6 0
3 years ago
Read 2 more answers
Other questions:
  • What is the electron transport chain and where is it located?
    10·1 answer
  • Why might the risk of infectious disease be high in a community that has no water treatment facility?
    15·1 answer
  • A mother of a 7-year-old child complains to the nurse that her child wets the bed at night. upon interaction with the child, the
    10·1 answer
  • How is the inside of the nucleus connected to the cytosol? Why is this connection vital for the cell?
    6·1 answer
  • How do aggregate fruits develop?
    9·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • An example for aheterotropic for feeding is what
    14·1 answer
  • PLEASE HELP ‼️URGENT‼️
    9·1 answer
  • Nicotine is a drug that stimulates nicotinic receptors. It will have an effect __________.
    9·1 answer
  • How would the role of gene expression in cells be best described?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!